United States
Germany
Japan
United Kingdom
China
Nppc (NM_010933) Mouse Untagged Clone
CAT＃: MC209051
Nppc (untagged) - Mouse natriuretic peptide type C (Nppc), (10ug)
CNY 3,990.00
Product images
CNY 5,467.00
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | C; CNP; lb; lbab |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC209051 representing NM_010933
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGCACCTCTCCCAGCTGATCGCCTGCGCCCTGCTGCTCGCGCTACTCTCGCTCCGGCCCTCTGAAGCCA AGCCCGGGACACCACCGAAGGTCCCGAGAACCCCGCCAGGGGAGGAGCTGGCGGATTCCCAGGCAGCTGG TGGCAATCAGAAAAAGGGTGACAAGACTCCAGGCAGCGGGGGAGCCAATCTCAAGGGAGACCGATCGCGA CTGCTCCGGGACCTGCGTGTGGACACCAAGTCCCGGGCTGCTTGGGCCCGCCTTCTGCACGAGCACCCCA ACGCGCGCAAATACAAAGGCGGCAACAAGAAGGGCTTGTCCAAAGGCTGCTTTGGCCTCAAGCTGGACCG GATCGGCTCCATGAGCGGTCTGGGATGTTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_010933 |
| Insert Size | 381 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_010933.5, NP_035063.1 |
| RefSeq Size | 1042 bp |
| RefSeq ORF | 381 bp |
| Locus ID | 18159 |
| UniProt ID | Q61839 |
| Gene Summary | This gene encodes a member of the natriuretic peptide family. Natriuretic peptides are involved in the control of blood pressure, extracellular fluid volume and electrolyte homeostasis. The encoded protein also plays a role in sensory neuron bifurcation, and is a critical regulator of endochondral bone growth. The encoded protein is a ligand for the natriuretic peptide receptor B, and is synthesized as a preprohormone which is cleaved to produce a mature peptide. Mutations in this gene are associated with dwarfism resulting from impaired endochondral ossification. [provided by RefSeq, Apr 2011] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG227595 | Nppc (tGFP-tagged) - Mouse natriuretic peptide precursor type C (Nppc), (10ug) |
CNY 2,850.00 |
|
| MR227595 | Nppc (Myc-DDK-tagged) - Mouse natriuretic peptide type C (Nppc) |
CNY 1,200.00 |
|
| MR227595L3 | Lenti ORF clone of Nppc (Myc-DDK-tagged) - Mouse natriuretic peptide type C (Nppc) |
CNY 4,750.00 |
|
| MR227595L4 | Lenti ORF clone of Nppc (mGFP-tagged) - Mouse natriuretic peptide type C (Nppc) |
CNY 4,750.00 |
