Emc8 (NM_010926) Mouse Untagged Clone
CAT#: MC209045
Emc8 (untagged) - Mouse COX4 neighbor (Cox4nb), (10ug)
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | Cox4nb; Fam158b; Noc4 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC209045 representing NM_010926
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGCCCGGCGTGAAGCTGACTACGCAGGCCTACTGCAAGATGGTGCTCCACGGCGCCAAGTACCCGCACT GCGCCGTCAACGGGCTCCTGGTGGCCGAGAGGCAGAGGCCGCGCAAGGAGCATCCTCCCGGAGCGGGCAG CCACACGCTCTTCGTGGACTGCATCCCGCTCTTCCACGGCACGCTGGCTCTGACGCCCATGCTGGAGGTG GCGCTCACCCTGATTGACTCGTGGTGCAAAGACAACAGCTATGTGATCGCTGGCTATTACCAAGCTAATG AGCGTGTGAAGGATGCCAGCCCAAACCAGGTGGCAGAAAAGGTGGCCTCCAGGATCGCAGAGGGCTTCGG TGATGCCGCACTCATCATGGTGGACAATGCCAAGTTCACGATGGACTGCGCAGCGCCCACGATCCACGTG TACGAGCAGCACGAGAACAGGTGGCGGTGCAGAGACCCACACCACGACTACTGTGAAGATTGGCCGGAGG CACAGAGGATCTCAGCTTCACTCCTGGACAGCCGCTCCTACGAAACACTCGTGGATTTTGATAATCATCT GGACGACATTCGGAGCGACTGGACAAACCCGGAGATCAACAAAGCAGTTCTGCACCTGTGCTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_010926 |
Insert Size | 624 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_010926.5, NP_035056.1 |
RefSeq Size | 4933 bp |
RefSeq ORF | 624 bp |
Locus ID | 18117 |
UniProt ID | O70378 |
Gene Summary | Part of the endoplasmic reticulum membrane protein complex (EMC) that enables the energy-independent insertion into endoplasmic reticulum membranes of newly synthesized membrane proteins. Preferentially accommodates proteins with transmembrane domains that are weakly hydrophobic or contain destabilizing features such as charged and aromatic residues. Involved in the cotranslational insertion of multi-pass membrane proteins in which stop-transfer membrane-anchor sequences become ER membrane spanning helices. It is also required for the post-translational insertion of tail-anchored/TA proteins in endoplasmic reticulum membranes. By mediating the proper cotranslational insertion of N-terminal transmembrane domains in an N-exo topology, with translocated N-terminus in the lumen of the ER, controls the topology of multi-pass membrane proteins like the G protein-coupled receptors. By regulating the insertion of various proteins in membranes, it is indirectly involved in many cellular processes.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG223957 | Emc8 (tGFP-tagged) - Mouse COX4 neighbor (Cox4nb), (10ug) |
CNY 2,280.00 |
|
MR223957 | Emc8 (Myc-DDK-tagged) - Mouse COX4 neighbor (Cox4nb) |
CNY 2,090.00 |
|
MR223957L3 | Lenti ORF clone of Emc8 (Myc-DDK-tagged) - Mouse COX4 neighbor (Cox4nb) |
CNY 3,990.00 |
|
MR223957L4 | Lenti ORF clone of Emc8 (mGFP-tagged) - Mouse COX4 neighbor (Cox4nb) |
CNY 3,990.00 |