United States
Germany
Japan
United Kingdom
China
Ndufa4 (NM_010886) Mouse Untagged Clone
CAT＃: MC209017
Ndufa4 (untagged) - Mouse NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4 (Ndufa4), nuclear gene encoding mitochondrial protein, (10ug)
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | MLRQ |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC209017 representing NM_010886
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGCTCCGCCAGATCCTCGGGCAAGCCAAGAAGCATCCCAGCTTGATTCCTCTCTTCGTATTTATTGGAG CAGGGGGTACTGGAGCAGCACTGTATGTGATGCGCTTGGCACTGTTTAATCCAGATGTCAGCTGGGACAG AAAGAACAACCCAGAGCCATGGAACAAACTGGGTCCCAATGAACAATATAAGTTCTACTCTGTGAATGTG GACTACAGCAAACTGAAGAAAGAAGGCCCAGACTTCTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_010886 |
| Insert Size | 249 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_010886.2, NP_035016.1 |
| RefSeq Size | 492 bp |
| RefSeq ORF | 249 bp |
| Locus ID | 17992 |
| UniProt ID | Q62425 |
| Gene Summary | Cytochrome c oxidase (COX, complex IV) is the terminal component of the mitochondrial respiratory chain that catalyzes the reduction of oxygen to water. Required for complex IV maintenance (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG216909 | Ndufa4 (tGFP-tagged) - Mouse NADH dehydrogenase (ubiquinone) 1 alpha subcomplex 4 (Ndufa4) nuclear gene encoding mitochondrial protein, (10ug) |
CNY 2,850.00 |
|
| MR216909 | Ndufa4 (Myc-DDK-tagged) - Mouse NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4 (Ndufa4), nuclear gene encoding mitochondrial protein |
CNY 1,200.00 |
|
| MR216909L3 | Lenti ORF clone of Ndufa4 (Myc-DDK-tagged) - Mouse NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4 (Ndufa4), nuclear gene encoding mitochondrial protein |
CNY 4,750.00 |
|
| MR216909L4 | Lenti ORF clone of Ndufa4 (mGFP-tagged) - Mouse NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4 (Ndufa4), nuclear gene encoding mitochondrial protein |
CNY 4,750.00 |
