Mxi1 (NM_001008542) Mouse Untagged Clone

CAT#: MC208997

Mxi1 (untagged) - Mouse Max interacting protein 1 (Mxi1), transcript variant 2, (10ug)



  "NM_001008542" in other vectors (4)

CNY 3,990.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms bHLHc11; Gm10197; Mad2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC208997 representing NM_001008542
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGGCAAACGCGGGCGGCCGCGCAAGGAGGCGCGCTGCGAGGGCGCGGGGCTGGTCCCCGTCGCGCCCC
CGGCCATGCCCCCGGCCGCGGCCGCGCCCCAGCCCCCGGCGCAGCCGGAGGAGCCGGCGGGGGCCAAGCC
CCGGTGCCCCTTCTCGGACATTTTCAACACCAGCGAGAACTCGATGGAGAAGCACATCAACACTTTTCTG
CAGAACGTGCAGATTCTGCTCGAGGCAGCCAGCTACCTGGAGCAGATCGAGAAAGAAAACAAAAAGTGTG
AACATGGCTACGCCTCATCGTTCCCCTCCATGCCGAGCCCCCGGCTACAGCACTCGAAGCCCCCACGGAG
GTTGAGCCGGGCACAGAAACACAGCAGTGGAAGCAGCAACACCAGCACTGCCAACAGATCTACACACAAT
GAGTTGGAAAAGAACCGACGAGCTCACCTGCGCCTGTGTTTAGAACGCTTGAAAGTTCTGATCCCGCTGG
GCCCAGACTGCACCAGGCACACAACACTCGGTTTGCTCAACAAAGCCAAAGCACACATCAAGAAACTTGA
AGAAGCGGAGAGGAAGAGCCAGCACCAGCTAGAGAACTTGGAACGAGAACAGAGGTTTTTAAAGCGGCGA
CTGGAACAGCTGCAGGGGCCTCAGGAGATGGAGCGGATACGAATGGACAGCATTGGATCAACCATCTCTT
CAGATCGCTCGGATTCAGAGCGAGAGGAGATTGAAGTGGATGTGGAAAGCACAGAGTTCTCCCATGGAGA
AGCAGACAGTGTCAGTACCACCAGCATCAGTGACCTTGACGACCACAGCAGCCTGCAGAGTGTCGGGAGT
GACGAGGGTTATTCCAGTGCCAGTGTCAAACTCTCCTTCGCGTCCTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001008542
Insert Size 888 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001008542.2, NP_001008542.2
RefSeq Size 5156 bp
RefSeq ORF 888 bp
Locus ID 17859
Gene Summary This gene encodes a protein containing a helix-loop-helix domain characteristic of transcription factors, which allows heterodimerization and sequence-specific DNA binding. The encoded protein is related to a family of Myc/Max/Mad proteins that are involved in the regulation of several cellular processes. The protein encoded by this gene is a transcriptional repressor thought to negatively regulate Myc function. Three alternatively spliced transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2), also referred to as SRalpha, differs in the 5' UTR and 5' coding region, compared to variant 1. The resulting isoform (b) is longer and has a distinct N-terminus compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...