Meis2 (NM_001159570) Mouse Untagged Clone

CAT#: MC208976

Meis2 (untagged) - Mouse Meis homeobox 2 (Meis2), transcript variant 6, (10ug)



  "NM_001159570" in other vectors (4)

CNY 3,990.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (4)
MEIS2 Antibody - middle region
    • 50 ug

CNY 4,628.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms A430109D20Rik; Mei; Mrg; Mrg1; Str; Stra10
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC208976 representing NM_001159570
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTTTCTGTACGATGAGCTGCCCCATTACGGCGGGATGGACGGAGTAGGGGTTCCCGCTTCCATGTACG
GAGACCCTCACGCGCCGCGGCCGATCCCCCCGGTTCACCACCTAAACCACGGGCCGCCGCTCCACGCCAC
GCAGCACTACGGCGCGCACGCCCCGCACCCCAATGTCATGCCAGCCAGCATGGGATCTGCTGTCAACGAC
GCCTTGAAAAGAGACAAGGACGCAATCTATGGGCACCCGTTGTTTCCTCTGTTAGCTCTGGTTTTTGAGA
AGTGCGAGCTGGCGACCTGCACTCCCCGGGAACCCGGAGTGGCCGGCGGAGACGTCTGTTCCTCTGACTC
CTTCAACGAGGACATCGCGGTCTTCGCCAAGCAGGTTCGCGCCGAAAAGCCTCTTTTTTCCTCAAACCCA
GAGCTGGATAATTTGATGATACAAGCAATTCAAGTACTAAGGTTTCATCTTCTGGAGTTAGAAAAGGTCC
ACGAACTATGTGATAACTTCTGCCACCGGTACATTAGCTGTTTGAAGGGAAAAATGCCCATTGACCTCGT
GATTGATGAGAGAGATGGAAGCTCCAAGTCAGATCATGAAGAACTTTCAGGCTCCTCCACAAATCTCGCC
GACCACAACCCTTCATCCTGGCGAGACCACGATGACGCAACCTCAACGCACTCCGCAGGCACCCCAGGAC
CCTCCAGTGGGGGCCATGCTTCCCAGAGTGGAGACAACAGCAGTGAGCAAGGCGATGGGTTAGACAACAG
CGTAGCTTCACCTGGCACAGGTGATGACGACGATCCAGACAAGGACAAAAAACGCCAGAAGAAAAGAGGC
ATATTCCCCAAAGTCGCGACAAATATCATGAGAGCGTGGCTCTTCCAGCATCTCACACACCCGTACCCTT
CAGAAGAACAGAAGAAACAGTTAGCGCAAGACACGGGACTGACAATTCTGCAAGTGAACAACTGGTTTAT
CAATGCCAGAAGAAGAATAGTGCAGCCCATGATTGACCAGTCAAATCGAGCAGTGAGCCAAGGAGCAGCG
TATAGTCCAGAGGGTCAGCCCATGGGGAGCTTTGTGTTGGATGGTCAGCAACACATGGGGATCCGGCCTG
CAGGACCCATGAGTGGAATGGGCATGAATATGGGCATGGATGGGCAGTGGCACTATATGTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001159570
Insert Size 1182 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001159570.1, NP_001153042.1
RefSeq Size 4989 bp
RefSeq ORF 1182 bp
Locus ID 17536
Gene Summary This gene encodes a homeobox protein belonging to the TALE ('three amino acid loop extension') family of homeodomain-containing proteins. TALE homeobox proteins are highly conserved transcriptional regulators and several members have been shown to be essential contributors to developmental programs. In mice, a knock-out of this gene leads to lethality at embryonic day 14, accompanied with hemorrhaging. Embryos lacking this gene show defects in tissues derived from the neural crest, suggesting a critical role of this gene during cranial and cardiac neural crest cell development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
Transcript Variant: This variant (6) has multiple differences in the coding region and differs in the 3' UTR, compared to variant 9. The encoded isoform (6) is shorter and has a distinct C-terminus compared to isoform 9. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...