Marcksl1 (NM_010807) Mouse Untagged Clone
CAT#: MC208965
Marcksl1 (untagged) - Mouse MARCKS-like 1 (Marcksl1), (10ug)
CNY 2,400.00
CNY 3,990.00
Cited in 1 publication. |
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | AL022768; AW215397; AW536807; D4Bc1; F52; MacMARCKS; Macs2; Macs3; Mlp; Mrp |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_010807, the custom clone sequence may differ by one or more nucleotides
ATGGGCAGCCAGAGCTCTAAGGCTCCCCGGGGCGACGTGACCGCCGAGGAGGCAGCGGGCGCTTCCCCCG CGAAGGCCAACGGACAGGAGAATGGCCACGTGAGAAGCAATGGAGACTTAACCCCCAAGGGTGAAGGGGA GTCACCACCCGTGAACGGAACAGATGAGGCAGCTGGGGCTACTGGTGATGCCATCGAGCCAGCGCCCCCT AGCCAGGAAGCTGAGGCCAAGGGGGAGGTCGCCCCCAAGGAGACCCCCAAGAAGAAGAAGAAATTCTCTT TCAAGAAGCCTTTCAAATTGAGTGGCCTGTCCTTCAAGAGAAATCGGAAGGAGGGTGGGGGTGATTCCTC AGCCTCCTCGCCAACAGAGGAAGAGCAGGAGCAGGGCGAGATGAGCGCCAGCAGCGACGAGGGCACTGCC CAAGAAGGGAAGGCCGCTGCCACCCCTGAGAGCCAAGAGCCCCAGGCCAAGGGGGCAGAGGCTAGTGCTG CCTCCAAGGAAGGAGACACAGAAGAGGAGGCAGGGCCCCAGGCTGCAGAGCCATCCACTCCCTCGGGCCC AGAGAGTGGCCCCACACCTGCCAGTGCTGAGCAGAATGAGTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_010807 |
Insert Size | 603 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC006757, AAH06757 |
RefSeq Size | 1536 bp |
RefSeq ORF | 603 bp |
Locus ID | 17357 |
UniProt ID | P28667 |
Gene Summary | Involved in the control of cell movement by regulating actin cytoskeleton homeostasis and filopodium and lamellipodium formation (PubMed:22751924). When unphosphorylated, induces cell migration (PubMed:22751924). When phosphorylated by MAPK8, induces actin bundles formation and stabilization, thereby reducing actin plasticity, hence restricting cell movement, including neuronal migration (PubMed:22751924). May be involved in coupling the protein kinase C and calmodulin signal transduction systems (Probable).[UniProtKB/Swiss-Prot Function] |
Citations (1)
The use of this cDNA Clones has been cited in the following citations: |
---|
MARCKS-like protein is an initiating molecule in axolotl appendage regeneration
,Sugiura, T;Wang, H;Barsacchi, R;Simon, A;Tanaka, EM;,
Nature
,PubMed ID 26934225
[MARCKSL1]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG219334 | Marcksl1 (tGFP-tagged) - Mouse MARCKS-like 1 (Marcksl1), (10ug) |
CNY 2,850.00 |
|
MR219334 | Marcksl1 (Myc-DDK-tagged) - Mouse MARCKS-like 1 (Marcksl1) |
CNY 2,400.00 |
|
MR219334L3 | Lenti ORF clone of Marcksl1 (Myc-DDK-tagged) - Mouse MARCKS-like 1 (Marcksl1) |
CNY 4,750.00 |
|
MR219334L4 | Lenti ORF clone of Marcksl1 (mGFP-tagged) - Mouse MARCKS-like 1 (Marcksl1) |
CNY 4,750.00 |
其它Marcksl1产品