Maf (NM_001025577) Mouse Untagged Clone
CAT#: MC208926
Maf (untagged) - Mouse avian musculoaponeurotic fibrosarcoma (v-maf) AS42 oncogene homolog (Maf), (10ug)
CNY 3,656.00
CNY 3,990.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 2810401A20Rik; A230108G15Rik; AW047063; c-maf |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC208926 representing NM_001025577
Red=Cloning site Blue=ORF TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCTTCAGAACTGGCAATGAACAATTCCGACCTGCCCACCAGTCCCCTGGCCATGGAATATGTTAATG ACTTCGATCTGATGAAGTTTGAAGTGAAAAAGGAACCGGTGGAGACCGACCGCATCATCAGCCAGTGCGG CCGTCTCATCGCCGGGGGCTCGCTGTCCTCCACCCCCATGAGCACGCCCTGCAGCTCGGTGCCCCCGTCC CCCAGCTTCTCGGCGCCCAGCCCGGGCTCGGGCAGCGAACAGAAGGCGCACCTGGAAGACTACTACTGGA TGACCGGCTACCCGCAGCAGCTCAACCCGGAGGCGCTGGGCTTCAGCCCGGAGGACGCGGTCGAGGCGCT CATCAGCAACAGCCACCAGCTCCAGGGTGGCTTCGATGGCTATGCGCGGGGAGCGCAGCAGCTGGCCGCG GCAGCGGGGGCCGGCGCCGGCGCCTCCCTGGGCGGCAGCGGCGAGGAGATGGGCCCCGCCGCCGCCGTGG TGTCCGCCGTGATCGCCGCGGCCGCCGCGCAGAGCGGCGCGGCACCCCACTACCATCACCACCACCACCA CGCCGCGGGGCACCACCACCATCCGACGGCCGGCGCCCCGGGAGCCGCGGGCGGCGCGTCTGCCTCTGCG AGCGGCGCGGGTGGCGCGGGCGGCGGTGGCCCGGCCAGCGCCGGGGGCGGCGGCGGCGGAGGCGGCGGCG GGGGCACGGCGGGGGCGGGGGGCGCCCTGCACCCGCACCATGCCGCGGGCGGCCTGCACTTCGACGACCG CTTCTCGGACGAGCAGTTGGTGACCATGTCGGTGCGCGAGCTGAACCGGCAGCTGCGCGGGGTCAGCAAG GAGGAGGTGATCCGACTGAAGCAGAAGAGGCGGACCCTGAAAAACCGCGGCTATGCCCAGTCCTGCCGCT TCAAGAGGGTGCAGCAGAGACACGTCCTGGAGTCGGAGAAGAACCAGCTGCTGCAGCAGGTAGACCACCT CAAGCAGGAGATCTCCAGGCTGGTGCGCGAAAGGGACGCCTACAAGGAGAAATACGAGAAGCTGGTGAGC AACGGCTTCCGAGAAAACGGCTCGAGCAGCGACAACCCTTCCTCTCCCGAATTTTTCATGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Chromatograms |
CHROMATOGRAMS
![]() Sequencher program is needed, download here. |
Restriction Sites | SgfI-MluI |
ACCN | NM_001025577 |
Insert Size | 1113 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001025577.2, NP_001020748.2 |
RefSeq Size | 3642 bp |
RefSeq ORF | 1113 bp |
Locus ID | 17132 |
UniProt ID | P54843 |
Gene Summary | Acts as a transcriptional activator or repressor. When overexpressed, represses anti-oxidant response element (ARE)-mediated transcription. Involved either as an oncogene or as a tumor suppressor, depending on the cell context. Binds to the ARE sites of detoxifying enzyme gene promoters (By similarity). Involved in embryonic lens fiber cell development. Recruits the transcriptional coactivators CREBBP and/or EP300 to crystallin promoters leading to up-regulation of crystallin gene during lens fiber cell differentiation. Activates the expression of IL4 in T helper 2 (Th2) cells. Increases T-cell susceptibility to apoptosis by interacting with MYB and decreasing BCL2 expression. Together with PAX6, transactivates strongly the glucagon gene promoter through the G1 element. Activates transcription of the CD13 proximal promoter in endothelial cells. Represses transcription of the CD13 promoter in early stages of myelopoiesis by affecting the ETS1 and MYB cooperative interaction. Involved in the initial chondrocyte terminal differentiation and the disappearance of hypertrophic chondrocytes during endochondral bone development. Binds to the sequence 5'-[GT]G[GC]N[GT]NCTCAGNN-3' in the L7 promoter. Binds to the T-MARE (Maf response element) sites of lens-specific alpha- and beta-crystallin gene promoters. Binds element G1 on the glucagon promoter. Binds an AT-rich region adjacent to the TGC motif (atypical Maf response element) in the CD13 proximal promoter in endothelial cells. It may interact with additional basic-zipper proteins that determine a subtype of Maf-responsive element binding.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG227131 | Maf (tGFP-tagged) - Mouse avian musculoaponeurotic fibrosarcoma (v-maf) AS42 oncogene homolog (Maf), (10ug) |
CNY 7,088.00 |
|
MR227131 | Maf (Myc-DDK-tagged) - Mouse avian musculoaponeurotic fibrosarcoma (v-maf) AS42 oncogene homolog (Maf) |
CNY 5,488.00 |
|
MR227131L3 | Lenti ORF clone of Maf (Myc-DDK-tagged) - Mouse avian musculoaponeurotic fibrosarcoma (v-maf) AS42 oncogene homolog (Maf) |
CNY 5,890.00 |
|
MR227131L4 | Lenti ORF clone of Maf (mGFP-tagged) - Mouse avian musculoaponeurotic fibrosarcoma (v-maf) AS42 oncogene homolog (Maf) |
CNY 5,890.00 |