Ly96 (NM_001159711) Mouse Untagged Clone
CAT#: MC208918
Ly96 (untagged) - Mouse lymphocyte antigen 96 (Ly96), transcript variant 2, (10ug)
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | ESOP-1; MD-2; MD2 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC208918 representing NM_001159711
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTTGCCATTTATTCTCTTTTCGACGCTGCTTTCTCCCATATTGACTGAATCTGAGAAGCAACAGTGGT TCTGCAACTCCTCCGATGCAATTATTTCCTACAGTTATTGTGATCACTTGAAATTCCCTATTTCAATTAG TTCTGAACCCTGCATAAGACTGAGGGGAACCAATGGATTTGTGCATGTTGAGTTCATTCCAAAGTTGCCG AAGCGTAAGGAAGTTCTGTGCCATGGACATGATGATGACTATTCTTTTTGCAGAGCTCTGAAAGGAGAGA CTGTGAATACATCAATACCATTCTCTTTCGAGGGAATACTATTTCCTAAGGGCCATTACAGATGTGTTGC AGAAGCTATTGCTGGGGATACTGAAGAAAAGCTCTTCTGTTTGAATTTCACCATCATTCACCGCCGTGAT GTCAATTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001159711 |
Insert Size | 429 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001159711.1, NP_001153183.1 |
RefSeq Size | 549 bp |
RefSeq ORF | 429 bp |
Locus ID | 17087 |
UniProt ID | Q9JHF9 |
Gene Summary | Binds bacterial lipopolysaccharide (LPS) (PubMed:22532668). Cooperates with TLR4 in the innate immune response to bacterial lipopolysaccharide (LPS), and with TLR2 in the response to cell wall components from Gram-positive and Gram-negative bacteria. Enhances TLR4-dependent activation of NF-kappa-B. Cells expressing both LY96 and TLR4, but not TLR4 alone, respond to LPS (PubMed:10725698).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) uses an alternate in-frame splice junction at the 5' end of an exon compared to variant 1. The resulting isoform (B) has the same N- and C-termini but is shorter compared to isoform A. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG225298 | Ly96 (tGFP-tagged) - Mouse lymphocyte antigen 96 (Ly96) transcript variant 2, (10ug) |
CNY 2,090.00 |
|
MR225298 | Ly96 (Myc-DDK-tagged) - Mouse lymphocyte antigen 96 (Ly96), transcript variant 2 |
CNY 1,900.00 |
|
MR225298L3 | Lenti ORF clone of Ly96 (Myc-DDK-tagged) - Mouse lymphocyte antigen 96 (Ly96), transcript variant 2 |
CNY 3,800.00 |
|
MR225298L4 | Lenti ORF clone of Ly96 (mGFP-tagged) - Mouse lymphocyte antigen 96 (Ly96), transcript variant 2 |
CNY 3,800.00 |