Klra2 (NM_008462) Mouse Untagged Clone

CAT#: MC208832

Klra2 (untagged) - Mouse killer cell lectin-like receptor, subfamily A, member 2 (Klra2), transcript variant 2, (10ug)



  "NM_008462" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal KLRA2 Antibody
    • 100 ug

CNY 5,808.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms Klra30; Ly49; Ly49b
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC208832 representing NM_008462
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAGTGAGCAGGAGGTCACTTACACAACTCTGAGATTTCATAAGTCTTCAGGGTTGCAGAACCCAGTGA
GGCCTGAGGAGACTCAAAGGCCCAGAGATGTGGGCCACAGAGAGTGTTCAGTCCCCTGGAAGTTCATTGT
GATAGTTCTTGGAATCCTCTGTTTCCTTCTGCTGGTAACTGTGGCAGTGTTGGTGATACACATTTTCCGG
GATGGACAAGAGAAACATGAACAGGAGAAAACTCTAAATAACCTCCGTCAAGAGTACCAGGTCATGAAAA
ATGACAGCTCCTTAATGGAAGAAATGTTAAGAAATAAGTCTTCAGAGTGTAAGGCCCTCAATGATAGCCT
GCACTACCTCAACAGAGAACAGAACAGATGCCTCAGGAAAACCAAGATTGTTTTAGATTGCTCACAGAAC
AAAGGCAAGCAAGTGGAAGGATACTGGTTCTGCTGTGGCATGAAATGTTATTATTTCATCATGGATGATA
AAAAATTGAAAGGATGTAAACAGATCTGCCAGGCTTACAACTTAACTCTTTTGAAGACAAATGATGAGGA
TGAATTGAAGTTCCTTAAATCCCAACTTCAAAGAAACACATACTGGATTGCACTGACACATCACGAAAGC
AAAGAGGAATCGCAACAGATTGGTGATAGACCATCTAAACCTGTTTCAGCAGCAAGGAATTCAGTACCTA
ATAGAGAAAAGTGTGCATATCTAAATTCATTTTCTACAGAAGAGGATGACCGTGCTAGAAATCATGGTTG
TATTTGTGAAAAGAGATTGAATAAATTCCCTATTCCAGGGAGCTGTGCCAAGGGAAGAACTCAATCTGCT
CTGCAGAGGGATGAAGATGAAAGTTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_008462
Insert Size 867 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_008462.5, NP_032488.4
RefSeq Size 1787 bp
RefSeq ORF 867 bp
Locus ID 16633
Gene Summary The gene is a member of the large lectin-like type 2 transmembrane receptor family of the natural killer gene complex. The gene is located distantly telomeric to its family's gene cluster on chromosome 6. The gene differs from the other genes in its cluster as its promoter region contains long and short interspersed repetitive elements suggesting a possible rearrangement or gene conversion. It is unknown whether this gene's encoded protein is involved with natural killer cell differentiation as are its other family members. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2010]
Transcript Variant: This variant (2) lacks an alternate in-frame exon in the 3' coding region compared to variant 1. The encoded isoform (2) is shorter compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...