Il11 (NM_008350) Mouse Untagged Clone

CAT#: MC208766

Il11 (untagged) - Mouse interleukin 11 (Il11), (10ug)



  "NM_008350" in other vectors (4)

CNY 2,400.00

CNY 3,990.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms IL-11
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC208766 representing NM_008350
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAACTGTGTTTGTCGCCTGGTCCTGGTGGTGCTGAGCCTCTGGCCAGATAGAGTCGTTGCCCCTGGGC
CACCAGCTGGCTCCCCTCGAGTCTCTTCAGACCCTCGAGCAGATCTGGACAGCGCTGTTCTCCTAACCCG
ATCCCTCCTGGCAGACACACGGCAACTAGCTGCACAGATGAGAGACAAATTCCCAGCTGACGGAGATCAC
AGTCTGGACTCCCTGCCCACCTTGGCCATGAGCGCTGGGACATTGGGATCTTTGCAGCTTCCTGGTGTGC
TGACAAGGCTTCGAGTAGACTTGATGTCCTACCTCCGGCATGTACAATGGCTGCGCCGTGCAGGTGGTCC
TTCCCTAAAGACTCTGGAGCCAGAGCTGGGTGCCCTGCAAGCCCGACTGGAACGGCTACTCCGCCGTTTA
CAGCTCTTGATGTCTCGCCTGGCCTTGCCCCAGGCAGCCCCAGACCAACCTGTGATCCCCCTGGGCCCTC
CTGCCTCAGCCTGGGGAAGCATCCGGGCAGCTCATGCCATCCTAGGAGGGCTGCACCTGACCTTGGACTG
GGCCGTGCGGGGCCTGCTGTTGTTAAAGACTCGACTGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Chromatograms CHROMATOGRAMS
Sequencher program is needed, download here.
Restriction Sites SgfI-MluI     
ACCN NM_008350
Insert Size 600 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_008350.4, NP_032376.1
RefSeq Size 1949 bp
RefSeq ORF 600 bp
Locus ID 16156
UniProt ID P47873
Gene Summary Cytokine that stimulates the proliferation of hematopoietic stem cells and megakaryocyte progenitor cells and induces megakaryocyte maturation resulting in increased platelet production (PubMed:8913282). Also promotes the proliferation of hepatocytes in response to liver damage (PubMed:22253262). Binding to its receptor formed by IL6ST and either IL11RA1 or IL11RA2 activates a signaling cascade that promotes cell proliferation, also in the context of various cancers (PubMed:10026196, PubMed:23948300). Signaling leads to the activation of intracellular protein kinases and the phosphorylation of STAT3 (PubMed:23948300, PubMed:22253262).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...