Id3 (NM_008321) Mouse Untagged Clone
CAT#: MC208734
Id3 (untagged) - Mouse inhibitor of DNA binding 3 (Id3), (10ug)
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | bHLHb25; Hlh462; Idb3 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC208734 representing NM_008321
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGAAGGCGCTGAGCCCGGTGCGCGGCTGCTACGAGGCGGTGTGCTGCCTGTCGGAACGTAGCCTGGCCA TTGCGCGAGGCCGCGGTAAGAGCCCGTCGACCGAGGAGCCTCTTAGCCTCTTGGACGACATGAACCACTG CTACTCGCGCCTGCGGGAACTGGTGCCGGGAGTCCCGCGAGGCACTCAGCTTAGCCAGGTGGAAATCCTG CAGCGTGTCATAGACTACATCCTCGACCTTCAGGTGGTCCTGGCAGAGCCGGCGCCTGGACCCCCGGACG GTCCGCATCTCCCGATCCAGACAGCTGAGCTCACTCCGGAACTTGTGATCTCCAAGGACAAGAGGAGCTT TTGCCACTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_008321 |
Insert Size | 360 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_008321.2, NP_032347.1 |
RefSeq Size | 964 bp |
RefSeq ORF | 360 bp |
Locus ID | 15903 |
UniProt ID | P41133 |
Gene Summary | Transcriptional regulator (lacking a basic DNA binding domain) which negatively regulates the basic helix-loop-helix (bHLH) transcription factors by forming heterodimers and inhibiting their DNA binding and transcriptional activity. Implicated in regulating a variety of cellular processes, including cellular growth, senescence, differentiation, apoptosis, angiogenesis, and neoplastic transformation. Involved in myogenesis by inhibiting skeletal muscle and cardiac myocyte differentiation and promoting muscle precursor cells proliferation. Inhibits the binding of E2A-containing protein complexes to muscle creatine kinase E-box enhancer. Regulates the circadian clock by repressing the transcriptional activator activity of the CLOCK-ARNTL/BMAL1 heterodimer.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG227292 | Id3 (tGFP-tagged) - Mouse inhibitor of DNA binding 3 (Id3), (10ug) |
CNY 2,850.00 |
|
MR227292 | Id3 (Myc-DDK-tagged) - Mouse inhibitor of DNA binding 3 (Id3) |
CNY 1,200.00 |
|
MR227292L3 | Lenti ORF clone of Id3 (Myc-DDK-tagged) - Mouse inhibitor of DNA binding 3 (Id3) |
CNY 3,600.00 |
|
MR227292L4 | Lenti ORF clone of Id3 (mGFP-tagged) - Mouse inhibitor of DNA binding 3 (Id3) |
CNY 3,600.00 |