Gjb1 (NM_008124) Mouse Untagged Clone

CAT#: MC208557

Gjb1 (untagged) - Mouse gap junction protein, beta 1 (Gjb1), (10ug)



  "NM_008124" in other vectors (4)

CNY 3,600.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (3)
GJB1 Antibody - middle region
    • 50 ug

CNY 4,628.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms Cnx32; connex; connexin-32; Cx32; Cxng
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC208557 representing NM_008124
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAACTGGACAGGTCTATACACCTTGCTCAGTGGCGTGAATCGGCACTCTACAGCCATTGGCCGAGTAT
GGCTGTCTGTCATCTTCATCTTCAGAATCATGGTGCTGGTGGTGGCTGCTGAGAGCGTGTGGGGGGATGA
GAAGTCCTCTTTCATCTGTAACACCCTCCAGCCGGGCTGCAACAGCGTCTGCTATGACCATTTTTTCCCC
ATCTCCCACGTGCGCCTATGGTCCCTGCAGCTTATCTTGGTTTCCACCCCAGCTCTCCTCGTGGCAATGC
ACGTAGCTCACCAACAGCACATAGAAAAGAAAATGCTACGGCTTGAGGGGCATGGGGACCCCCTTCACCT
GGAAGAGGTAAAGAGACACAAGGTGCACATCTCAGGGACACTGTGGTGGACCTATGTCATCAGTGTGGTG
TTCCGGCTGCTGTTCGAGGCTGTCTTCATGTATGTCTTCTATCTGCTCTACCCCGGCTATGCCATGGTGC
GGCTGGTCAAGTGTGAAGCCTTCCCCTGCCCCAACACAGTGGACTGCTTCGTGTCCCGCCCCACCGAGAA
AACCGTCTTCACTGTCTTTATGCTCGCAGCCTCCGGCATCTGCATTATCCTCAACGTGGCGGAGGTGGTG
TACCTCATCATCCGGGCCTGTGCCCGCCGTGCTCAGCGCCGCTCCAATCCGCCCTCCCGCAAGGGCTCGG
GCTTCGGCCACCGCCTCTCACCTGAATACAAGCAGAATGAGATCAACAAGCTGCTGAGCGAGCAGGATGG
CTCTCTGAAAGACATACTGCGCCGCAGCCCTGGCACAGGGGCCGGGCTCGCTGAAAAGAGCGACCGATGC
TCAGCCTGCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Chromatograms CHROMATOGRAMS
Sequencher program is needed, download here.
Restriction Sites SgfI-MluI     
ACCN NM_008124
Insert Size 852 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_008124.3, NP_032150.2
RefSeq Size 1519 bp
RefSeq ORF 852 bp
Locus ID 14618
UniProt ID P28230
Gene Summary This gene is a member of the gap junction protein (connexin) family. The encoded protein is a component of gap junctions, which are composed of arrays of intercellular channels that provide a route for the diffusion of ions and small molecules between cells. Mutations in a similar gene in human cause X-linked Charcot-Marie-Tooth disease, an inherited peripheral neuropathy. Alternative splicing results in multiple transcript variants encoding the same protein. [provided by RefSeq, Oct 2014]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...