Dmtn (NM_013514) Mouse Untagged Clone

CAT#: MC208441

Dmtn (untagged) - Mouse erythrocyte protein band 4.9 (Epb4.9), (10ug)



  "NM_013514" in other vectors (4)

CNY 3,990.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms AI325486; dematin; Epb4.9; Epb49
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC208441 representing NM_013514
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAACGTCTGCAGAAGCAACCTCTTACCTCCCCGGGGAGCGTCAGCTCCTCCAGAGACTCCAGTGTGC
CCGGCTCTCCCTCCAGCATCGTGGCCAAGATGGACAACCAGGTGTTGGGCTACAAGGATCTGGCTGCCAT
CCCCAAGGACAAGGCCATCCTGGACATTGAGCGACCTGACCTCATGATCTATGAGCCCCACTTTACCTAT
TCCCTCCTGGAACATGTAGAGCTGCCCAGAAGCCGGGAGTGCTCACTGTCACCCAAATCCACATCCCCCC
CACCGTCTCCAGAGGTGTGGGCGGAGAGCCGGACTCTTGGAATCATCTCTCAGGCTTCAACCCCAAGGAC
CACAGGGACCCCCAGGACCAGCCTGCCCCACTTCCACCACCCTGAGACTACCCGCCCGGATTCCAACATC
TACAAGAAGCCACCCATCTACAAACAGAGAGAATCCGTGGGAGGCAGCCCTCAGAGCAAGCACCTCATCG
AGGACCTCATCATCGAATCCTCCAAGTTTCCTGCAGCGCAGCCCCCTGACCCCAACCAGCCAGCCAAGAT
AGAGACTGACTACTGGCCATGTCCCCCGTCGCTGGCCGTTGTGGAGACAGAATGGAGGAAACGGAAGGCA
TCTCGAAAGGGGGCAGAGGAAGAGGAGGAAGAGGAAGACGATGACTCTGAAGAGGAGATTAAGGCCATCA
GGGAACGGCAGAAAGAGGAGCTCAGTAAGGTTACTTCCAACTTGGGAAAGATGATCTTGAAAGAAGAGAT
GGAAAAGTCATTGCCCATCCGGAGGAAAACACGCTCTCTGCCTGACCGGACACCCTTCCATACCTCCTTG
CATTCGGGAACATCTAAATCCTCTTCGCTTCCTTCCTATGGCAGGACCACCCTGAGCCGGCTACAGTCCA
CAGAATTCAGCCCATCGGGAAGTGAGGCTGGGAGCCCAGGCCTGCAGATCTATCCCTATGAGATGCTGGT
GGTGACCAATAAGGGGAGAACTAAGCTGCCTCCGGGTGTGGACCGCATGAGGCTTGAGAGGCATTTGTCA
GCAGAGGACTTCTCTAGGGTCTTCGCCATGTCTCCCGAGGAGTTTGGCAAGCTGGCCCTGTGGAAGCGGA
ACGAACTTAAGAAGAAAGCTTCCCTCTTCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_013514
Insert Size 1152 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_013514.4, NP_038542.1
RefSeq Size 4129 bp
RefSeq ORF 1152 bp
Locus ID 13829
UniProt ID Q9WV69
Gene Summary Membrane-cytoskeleton-associated protein with F-actin-binding activity that induces F-actin bundles formation and stabilization. Its F-actin-bundling activity is reversibly regulated upon its phosphorylation by the cAMP-dependent protein kinase A (PKA). Binds to the erythrocyte membrane glucose transporter-1 SLC2A1/GLUT1, and hence stabilizes and attaches the spectrin-actin network to the erythrocytic plasma membrane. Plays a role in maintaining the functional integrity of PKA-activated erythrocyte shape and the membrane mechanical properties. Plays also a role as a modulator of actin dynamics in fibroblasts; acts as negative regulator of the RhoA activation pathway. In platelets, functions as a regulator of internal calcium mobilization across the dense tubular system that affects platelet granule secretion pathways and aggregation. Also required for the formation of a diverse set of cell protrusions, such as filopodia and lamellipodia, necessary for platelet cell spreading, motility and migration. Acts as a tumor suppressor and inhibits malignant cell transformation.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) differs in the 5' UTR and lacks an in-frame coding exon in the 3' region, compared to variant 1. The resulting isoform (2) lacks an internal segment, compared to isoform 1. Variants 2, 3 and 10 encode the same isoform 2. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...