United States
Germany
Japan
United Kingdom
China
Dazl (NM_010021) Mouse Untagged Clone
CAT＃: MC208363
Dazl (untagged) - Mouse deleted in azoospermia-like (Dazl), (10ug)
CNY 2,400.00
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | Da; Daz-l; Daz-like; Dazh; Dazl1; Dazla; Tpx; Tpx-; Tpx-2; Tpx2 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>NCBI ORF sequence for NM_010021, the custom clone sequence may differ by one or more nucleotides
ATGTCTGCCACAACTTCTGAGGCTCCAAATTCAGCTGTCTCCAGGGAGGCCAGCACTCAGTCTTCATCAG CAACCACAAGTCAAGGATATGTTTTGCCAGAAGGCAAAATCATGCCAAACACCGTTTTTGTTGGAGGAAT TGATGTTAGGATGGATGAAACCGAAATCAGGAGTTTCTTTGCCAGATATGGCTCAGTAAAAGAAGTGAAG ATAATCACTGATCGAACTGGTGTGTCGAAGGGCTATGGATTTGTCTCATTTTATAATGACGTGGATGTGC AGAAGATAGTAGAATCACAGATAAATTTCCATGGTAAAAAGCTGAAACTGGGCCCTGCAATCAGGAAACA AAATTTATGTACTTATCATGTGCAGCCACGTCCTTTGATTTTTAATCCTCCTCCTCCACCACAGTTCCAG AGTGTTTGGAGTAGTCCAAATGCTGAGACTTACATGCAGCCTCCAACCATGATGAATCCTATCACTCAGT ATGTTCAGGCATATCCTCCTTATCCAAGTTCACCAGTTCGGGTCATCACTGGATATCAGCTGCCTGTTTA TAACTACCAGATGCCACCGCAGTGGCCTGCTGGAGAGCAGAGGAGTTATGTTATACCTCCGGCTTATACA ACTGTTAACTACCACTGCAGTGAAGTTGATCCAGGAGCTGATATTTTGCCCAATGAATGTTCAGTTCATG ATGCTGCTCCAGCTTCTGGAAATGGCCCGCAAAAGAAGTCTGTGGACCGAAGCATACAGACAGTGGTCTC TTGTCTGTTTAACCCTGAGAACAGGCTGAGAAACTCTCTTGTTACTCAAGATGACTACTTCAAGGATAAA AGAGTACATCACTTCAGAAGAAGTCGGGCAGTGCTTAAATCTGATCATCTCTGCTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_010021 |
| Insert Size | 897 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | BC099940, AAH99940 |
| RefSeq Size | 2936 bp |
| RefSeq ORF | 897 bp |
| Locus ID | 13164 |
| UniProt ID | Q64368 |
| Gene Summary | This gene encodes a member of the depleted in azoospermia-like (DAZL) protein family. Members of this family contain an RNA recognition motif, interact with poly A binding proteins, and may be involved in the initiation of translation. The encoded protein is expressed in the cytoplasm of pluripotent stem cells, and in both male and female germ cells, where it is essential for gametogenesis. Disruption of this gene is associated with infertility. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2013] Transcript Variant: This variant (1, also known as Dazl_FL) represents the longer transcript and encodes the longer isoform (1). |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG222245 | Dazl (tGFP-tagged) - Mouse deleted in azoospermia-like (Dazl), (10ug) |
CNY 2,850.00 |
|
| MR222245 | Dazl (Myc-DDK-tagged) - Mouse deleted in azoospermia-like (Dazl) |
CNY 2,081.00 |
|
| MR222245L3 | Lenti ORF clone of Dazl (Myc-DDK-tagged) - Mouse deleted in azoospermia-like (Dazl) |
CNY 4,750.00 |
|
| MR222245L4 | Lenti ORF clone of Dazl (mGFP-tagged) - Mouse deleted in azoospermia-like (Dazl) |
CNY 4,750.00 |
