United States
Germany
Japan
United Kingdom
China
Crem (NM_001110854) Mouse Untagged Clone
CAT＃: MC208323
Crem (untagged) - Mouse cAMP responsive element modulator (Crem), transcript variant 10, (10ug)
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | IC; ICER; ICERI |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC208323 representing NM_001110854
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGCAAAAGCCCAACATGGCTGTAACTGGAGATGAAACTGATGAGGAGACTGACCTTGCCCCAAGTCACA TGGCTGCTGCCACAGGTGACATGCCAACTTACCAGATCCGAGCTCCTACTACTGCTTTGCCACAAGGTGT GGTGATGGCTGCCTCACCAGGAAGCCTGCACAGTCCCCAGCAACTAGCAGAAGAAGCAACTCGCAAGCGG GAGCTGAGGCTGATGAAAAACAGGGAAGCTGCCCGGGAGTGTCGCAGGAAGAAGAAAGAATATGTCAAAT GTCTTGAAAATCGTGTGGCTGTGCTTGAAAATCAAAACAAGACCCTCATTGAGGAACTCAAGGCCCTCAA AGACCTTTATTGCCATAAAGCAGAGTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001110854 |
| Insert Size | 378 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001110854.1, NP_001104324.2 |
| RefSeq Size | 2046 bp |
| RefSeq ORF | 378 bp |
| Locus ID | 12916 |
| UniProt ID | P27699 |
| Gene Summary | This gene encodes a basic-leucine zipper domain-containing protein that localizes to gene promoters, where it binds to the cyclic AMP response element (CRE). Different protein isoforms encoded by this gene may function as either activators or repressors of transcription. Activity of this gene is important in multiple developmental processes, including spermatogenesis. Mutation of this gene causes male infertility. Alternative splicing and promoter usage result in multiple transcript variants for this gene. [provided by RefSeq, Oct 2012] Transcript Variant: This variant (10) contains multiple differences in the UTRs and coding region, including lacking multiple exons, compared to variant 1. It represents use of an alternate promoter and contains an alternate 5' coding region. The encoded isoform (10) is shorter and has distinct N- and C- termini, compared to isoform 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG222538 | Crem (tGFP-tagged) - Mouse cAMP responsive element modulator (Crem) transcript variant 10, (10ug) |
CNY 2,090.00 |
|
| MR222538 | Crem (Myc-DDK-tagged) - Mouse cAMP responsive element modulator (Crem), transcript variant 10 |
CNY 1,900.00 |
|
| MR222538L3 | Lenti ORF clone of Crem (Myc-DDK-tagged) - Mouse cAMP responsive element modulator (Crem), transcript variant 10 |
CNY 3,800.00 |
|
| MR222538L4 | Lenti ORF clone of Crem (mGFP-tagged) - Mouse cAMP responsive element modulator (Crem), transcript variant 10 |
CNY 3,800.00 |
