Ap3s1 (NM_009681) Mouse Untagged Clone
CAT#: MC208132
Ap3s1 (untagged) - Mouse adaptor-related protein complex 3, sigma 1 subunit (Ap3s1), (10ug)
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | [s] |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC208132 representing NM_009681
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGATCAAGGCCATCCTCATCTTCAACAACCACGGGAAGCCGCGGCTCTCCAAGTTCTACCAGCCCTATA GTGAAGACACGCAACAGCAAATCATCAGGGAGACTTTCCATTTGGTGTCTAAGCGCGATGAGAACGTTTG TAATTTCCTAGAAGGAGGATTATTAATTGGAGGCTCTGACAACAAGCTCATTTACAGACATTATGCAACA CTATATTTTGTCTTCTGTGTGGACTCCTCAGAAAGTGAACTTGGCATTTTAGATCTAATTCAAGTATTTG TGGAAACATTAGACAAATGTTTTGAAAATGTTTGTGAACTGGATTTAATATTCCATGTAGACAAGGTTCA TAATATTCTTGCAGAAATGGTGATGGGGGGAATGGTATTGGAGACCAACATGAATGAGATTGTCACACAA ATTGATGCACAAAATAAACTGGAGAAATCTGAGGCTGGCTTAGCAGGAGCTCCAGCCCGTGCTGTATCAG CTGTAAAGAATATGAATCTTCCTGAGATCCCAAGAAATATTAACATTGGTGACATCAGTATAAAAGTGCC AAACCTGCCCTCTTTTAAATAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_009681 |
Insert Size | 582 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_009681.5, NP_033811.1 |
RefSeq Size | 1520 bp |
RefSeq ORF | 582 bp |
Locus ID | 11777 |
UniProt ID | Q9DCR2 |
Gene Summary | This gene encodes the sigma subunit of the heterotetrameric adaptor protein complex AP-3 which is involved in the formation of specialized lysosome-related compartments such as melanosomes. Alternate splicing of this gene results in multiple transcript variants encoding different isoforms. Pseudogenes of this gene are found on chromosomes 1, 8, 16, 17 and X. [provided by RefSeq, Dec 2014] Transcript Variant: This variant (1) represents the shorter transcript and encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG222053 | Ap3s1 (tGFP-tagged) - Mouse adaptor-related protein complex 3 sigma 1 subunit (Ap3s1), (10ug) |
CNY 2,850.00 |
|
MR222053 | Ap3s1 (Myc-DDK-tagged) - Mouse adaptor-related protein complex 3, sigma 1 subunit (Ap3s1) |
CNY 2,400.00 |
|
MR222053L3 | Lenti ORF clone of Ap3s1 (Myc-DDK-tagged) - Mouse adaptor-related protein complex 3, sigma 1 subunit (Ap3s1) |
CNY 4,750.00 |
|
MR222053L4 | Lenti ORF clone of Ap3s1 (mGFP-tagged) - Mouse adaptor-related protein complex 3, sigma 1 subunit (Ap3s1) |
CNY 4,750.00 |