United States
Germany
Japan
United Kingdom
China
Ghrl (NM_021488) Mouse Untagged Clone
CAT＃: MC208061
Ghrl (untagged) - Mouse ghrelin (Ghrl), (10ug)
CNY 1,200.00
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | 2210006E23Rik; Gh; Ghr; m46; MT; MTLRP; MTLRPAP |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC208061 representing NM_021488
Red=Cloning site Blue=ORF TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGCTGTCTTCAGGCACCATCTGCAGTTTGCTGCTACTCAGCATGCTCTGGATGGACATGGCCATGGCAG GCTCCAGCTTCCTGAGCCCAGAGCACCAGAAAGCCCAGCAGAGAAAGGAATCCAAGAAGCCACCAGCTAA ACTGCAGCCACGAGCTCTGGAAGGCTGGCTCCACCCAGAGGACAGAGGACAAGCAGAAGAGACAGAGGAG GAGCTGGAGATCAGGTTCAATGCTCCCTTCGATGTTGGCATCAAGCTGTCAGGAGCTCAGTATCAGCAGC ATGGCCGGGCCCTGGGGAAGTTTCTTCAGGATATCCTCTGGGAAGAGGTCAAAGAGGCGCCAGCTGACAA GTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Chromatograms |
CHROMATOGRAMS
 Sequencher program is needed, download here. |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_021488 |
| Insert Size | 354 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_021488.4, NP_067463.2 |
| RefSeq Size | 527 bp |
| RefSeq ORF | 354 bp |
| Locus ID | 58991 |
| UniProt ID | Q9EQX0 |
| Gene Summary | This gene encodes a preproprotein that undergoes proteolytic processing to yield two bioactive peptides, ghrelin and obestatin. The hormone ghrelin plays a role in enhancing appetite and has numerous other biological functions that include stimulating the secretion of growth hormone (somatotropin) from the anterior pituitary gland. Obestatin is thought to be a hormone that functions in decreasing appetite. Mice lacking the encoded protein develop normally and exhibit no gross anatomical abnormalities. This gene encodes distinct isoforms, some or all of which may undergo similar proteolytic processing. [provided by RefSeq, Jul 2016] Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1). |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MR212134 | Ghrl (Myc-DDK-tagged) - Mouse ghrelin (Ghrl) |
CNY 1,200.00 |
|
| MR212134L3 | Lenti ORF clone of Ghrl (Myc-DDK-tagged) - Mouse ghrelin (Ghrl) |
CNY 4,750.00 |
|
| MR212134L4 | Lenti ORF clone of Ghrl (mGFP-tagged) - Mouse ghrelin (Ghrl) |
CNY 4,750.00 |
