Cd47 (NM_010581) Mouse Untagged Clone

CAT#: MC208027

Cd47 (untagged) - Mouse CD47 antigen (Rh-related antigen, integrin-associated signal transducer) (Cd47), (10ug)



  "NM_010581" in other vectors (6)

CN¥ 3,600.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (3)
CD47 Rabbit pAb
    • 100 ul

CN¥ 2,640.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CN¥ 4,090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CN¥ 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 9130415E20Rik; AA407862; AI848868; AW108519; B430305P08Rik; IAP; Itgp
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC208027 representing NM_010581
Red=Cloning site Blue=ORF

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTGGCCCTTGGCGGCGGCGCTGTTGCTGGGCTCCTGCTGCTGCGGTTCAGCTCAACTACTGTTTAGTA
ACGTCAACTCCATAGAGTTCACTTCATGCAATGAAACTGTGGTCATCCCTTGCATCGTCCGTAATGTGGA
GGCGCAAAGCACCGAAGAAATGTTTGTGAAGTGGAAGTTGAACAAATCGTATATTTTCATCTATGATGGA
AATAAAAATAGCACTACTACAGATCAAAACTTTACCAGTGCAAAAATCTCAGTCTCAGACTTAATCAATG
GCATTGCCTCTTTGAAAATGGATAAGCGCGATGCCATGGTGGGAAACTACACTTGCGAAGTGACAGAGTT
ATCCAGAGAAGGCAAAACAGTTATAGAGCTGAAAAACCGCACGGCCTTCAACACTGACCAAGGATCAGCC
TGTTCTTACGAGGAGGAGAAAGGAGGTTGCAAATTAGTTTCGTGGTTTTCTCCAAATGAAAAGATCCTCA
TTGTTATTTTCCCAATTTTGGCTATACTCCTGTTCTGGGGAAAGTTTGGTATTTTAACACTCAAATATAA
ATCCAGCCATACGAATAAGAGAATCATTCTGCTGCTCGTTGCCGGGCTGGTGCTCACAGTCATCGTGGTT
GTTGGAGCCATCCTTCTCATCCCAGGAGAAAAGCCCGTGAAGAATGCTTCTGGACTTGGCCTCATTGTGA
TCTCTACGGGGATATTAATACTACTTCAGTACAATGTGTTTATGACAGCTTTTGGAATGACCTCTTTCAC
CATTGCCATATTGATCACTCAAGTGCTGGGCTACGTCCTTGCTTTGGTCGGGCTGTGTCTCTGCATCATG
GCATGTGAGCCAGTGCACGGCCCCCTTTTGATTTCAGGTTTGGGGATCATAGCTCTAGCAGAACTACTTG
GATTAGTTTATATGAAGTTTGTCGCTTCCAACCAGAGGACTATCCAACCTCCTAGGAATAGGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_010581
Insert Size 975 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC012667, AAH12667
RefSeq Size 1870 bp
RefSeq ORF 975 bp
Locus ID 16423
UniProt ID Q61735
Gene Summary Has a role in both cell adhesion by acting as an adhesion receptor for THBS1 on platelets, and in the modulation of integrins. Plays an important role in memory formation and synaptic plasticity in the hippocampus. Receptor for SIRPA, binding to which prevents maturation of immature dendritic cells and inhibits cytokine production by mature dendritic cells. Interaction with SIRPG mediates cell-cell adhesion, enhances superantigen-dependent T-cell-mediated proliferation and costimulates T-cell activation. May play a role in membrane transport and/or integrin dependent signal transduction. May prevent premature elimination of red blood cells. May be involved in membrane permeability changes induced following virus infection (By similarity).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...