Elob (NM_026305) Mouse Untagged Clone
CAT#: MC207633
Tceb2 (untagged) - Mouse transcription elongation factor B (SIII), polypeptide 2 (Tceb2), (10ug)
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 0610040H15Rik; Tceb2 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC207633 representing NM_026305
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGACGTGTTTCTCATGATCCGGCGCCACAAGACCACCATCTTTACGGACGCCAAGGAGTCGAGCACCG TGTTCGAACTGAAGCGCATCGTCGAGGGCATCCTCAAGCGGCCGCCAGAGGAGCAGCGGCTTTACAAGGA TGACCAGCTCCTTGATGATGGCAAAACTCTGGGCGAGTGTGGCTTCACTAGCCAGACAGCACGGCCACAG GCCCCAGCCACAGTGGGCCTGGCCTTCCGAGCAGATGACACCTTCGAAGCTCTCCGCATCGAGCCCTTTT CCAGCCCTCCAGAGCTTCCAGATGTGATGAAGCCACAGGATTCTGGAGGCAGTGCCAATGAACAAGCTGT GCAGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_026305 |
Insert Size | 357 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_026305.2, NP_080581.1 |
RefSeq Size | 508 bp |
RefSeq ORF | 357 bp |
Locus ID | 67673 |
UniProt ID | P62869 |
Gene Summary | SIII, also known as elongin, is a general transcription elongation factor that increases the RNA polymerase II transcription elongation past template-encoded arresting sites. Subunit A is transcriptionally active and its transcription activity is strongly enhanced by binding to the dimeric complex of the SIII regulatory subunits B and C (elongin BC complex) (By similarity). In embryonic stem cells, the elongin BC complex is recruited by EPOP to Polycomb group (PcG) target genes in order generate genomic region that display both active and repressive chromatin properties, an important feature of pluripotent stem cells (PubMed:27863225, PubMed:27863226).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG200551 | Tceb2 (tGFP-tagged) - Mouse transcription elongation factor B (SIII), polypeptide 2 (Tceb2) |
CNY 2,850.00 |
|
MR200551 | Tceb2 (Myc-DDK-tagged) - Mouse transcription elongation factor B (SIII), polypeptide 2 (Tceb2) |
CNY 1,200.00 |
|
MR200551L3 | Lenti ORF clone of Tceb2 (Myc-DDK-tagged) - Mouse transcription elongation factor B (SIII), polypeptide 2 (Tceb2) |
CNY 4,750.00 |
|
MR200551L4 | Lenti ORF clone of Tceb2 (mGFP-tagged) - Mouse transcription elongation factor B (SIII), polypeptide 2 (Tceb2) |
CNY 4,750.00 |