Ube2t (NM_026024) Mouse Untagged Clone

CAT#: MC207614

Ube2t (untagged) - Mouse ubiquitin-conjugating enzyme E2T (putative) (Ube2t), (10ug)



  "NM_026024" in other vectors (3)

CN¥ 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CN¥ 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CN¥ 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CN¥ 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 2700084L22Rik; C80607
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC207614 representing NM_026024
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCAGAGAGCCTCACGCCTGAAGAAGGAACTGCACATGCTAGCCATCGAACCTCCCCCGGGCATCACGT
GCTGGCAGGAAAAGGATCAAGTGGCTGATTTGCGAGCTCAAATACTAGGTGGAGCTAATACACCTTATGA
GAAAGGTGTTTTCACACTGGAAGTTATCATTCCTGAGAGGTACCCATTTGAACCTCCACAGGTCCGATTT
CTAACTCCAATCTATCATCCAAACATTGATTCTAGTGGAAGGATTTGTCTAGATATTCTCAAATTGCCAC
CAAAGGGTGCATGGAGACCATCCCTCAACATTGCCACTGTATTGACCTCTATTCAGCTGCTCATGGCAGA
ACCCAATCCTGATGACCCACTAATGGCTGACATTTCTTCAGAATTTAAATATAACAAGATAGCTTTTCTC
AAGAAAGCCAAGCAGTGGACAGAGGCTCATGCAAGACAGAAACAAAAGGCTGATGAAGAGGAGCTAGGCA
CCTCATCAGAAGTTGGTGACTCTGAGGAAAGCCATTCCACACAGAAAAGGAAGGCCAGGCCATTAGGAGG
AATGGAAAAAAAGTTTTCCCCTGACGTTCAGAGAGTCTATCCTGGTCCCTCTTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_026024
Insert Size 615 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_026024.3, NP_080300.1
RefSeq Size 1134 bp
RefSeq ORF 615 bp
Locus ID 67196
UniProt ID Q9CQ37
Gene Summary Accepts ubiquitin from the E1 complex and catalyzes its covalent attachment to other proteins. Catalyzes monoubiquitination. Involved in mitomycin-C (MMC)-induced DNA repair: acts as a specific E2 ubiquitin-conjugating enzyme for the Fanconi anemia complex by associating with E3 ubiquitin-protein ligase FANCL and catalyzing monoubiquitination of FANCD2, a key step in the DNA damage pathway. Also mediates monoubiquitination of FANCL and FANCI. May contribute to ubiquitination and degradation of BRCA1. In vitro able to promote polyubiquitination using all 7 ubiquitin Lys residues, but may prefer 'Lys-11'-, 'Lys-27'-, 'Lys-48'- and 'Lys-63'-linked polyubiquitination.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longer variant. Variants 1 and 2 encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...