Lat2 (NM_022964) Mouse Untagged Clone

CAT#: MC207535

Lat2 (untagged) - Mouse linker for activation of T cells family, member 2 (Lat2), transcript variant 2, (10ug)



  "NM_022964" in other vectors (4)

CN¥ 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CN¥ 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CN¥ 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CN¥ 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms AW125574; LAB; NTAL; Wbscr5; Wbscr15; WSCR5
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC207535 representing NM_022964
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAGTGCCGAGCTGGAGCTGCTGTGGCCGGTGTCGGGATTATTGCTGCTGCTGTTGGGGGCCACAGCCT
GGCTGTGTGTCCACTGCTCCCGTCCAGGAGTGAAGAGAAATGAGAAAATCTACGAGCAGAGGAACCGGCA
AGAAAATGCACAGAGCTCAGCTGCGGCTCAGACATACTCCCTGGCCAGGCAGGTGTGGCCAGGACCCCAG
ATGGACACAGCTCCAAACAAGTCATTTGAAAGGAAGAACAAGATGCTGTTCTCCCACCTTGAGGGAAGTA
ACCAGGAGCCTGATGCTGCCTATGTAGACCCCATCCCTACAAACTACTACAACTGGGGATGTTTCCAGAA
GCCCTCAGAAGACGACGATTCCAACTCCTACGAGAATGTGCTCGTCTGCAAGCCCAGCACCCCCGAGTCA
GGTGTCGAGGACTTTGAGGATTACCAGAACTCAGTATCCATCCATCAGTGGCGAGAGTCCAAGAGGACTA
TGGGTGCACCAATGTCCCTATCAGGAAGCCCAGATGAGGAGCCAGACTATGTGAATGGGGATGTGGCCGC
AGCAGAGAACATCTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_022964
Insert Size 576 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_022964.4, NP_075253.2
RefSeq Size 1636 bp
RefSeq ORF 576 bp
Locus ID 56743
UniProt ID Q9JHL0
Gene Summary Involved in FCER1 (high affinity immunoglobulin epsilon receptor)-mediated signaling in mast cells. May also be involved in BCR (B-cell antigen receptor)-mediated signaling in B-cells and FCGR1 (high affinity immunoglobulin gamma Fc receptor I)-mediated signaling in myeloid cells. Couples activation of these receptors and their associated kinases with distal intracellular events through the recruitment of GRB2.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) lacks an alternate in-frame exon in the 5' coding region, compared to variant 1. It encodes isoform b, which is shorter than isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...