Lat2 (NM_022964) Mouse Untagged Clone
CAT#: MC207535
Lat2 (untagged) - Mouse linker for activation of T cells family, member 2 (Lat2), transcript variant 2, (10ug)
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | AW125574; LAB; NTAL; Wbscr5; Wbscr15; WSCR5 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC207535 representing NM_022964
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGAGTGCCGAGCTGGAGCTGCTGTGGCCGGTGTCGGGATTATTGCTGCTGCTGTTGGGGGCCACAGCCT GGCTGTGTGTCCACTGCTCCCGTCCAGGAGTGAAGAGAAATGAGAAAATCTACGAGCAGAGGAACCGGCA AGAAAATGCACAGAGCTCAGCTGCGGCTCAGACATACTCCCTGGCCAGGCAGGTGTGGCCAGGACCCCAG ATGGACACAGCTCCAAACAAGTCATTTGAAAGGAAGAACAAGATGCTGTTCTCCCACCTTGAGGGAAGTA ACCAGGAGCCTGATGCTGCCTATGTAGACCCCATCCCTACAAACTACTACAACTGGGGATGTTTCCAGAA GCCCTCAGAAGACGACGATTCCAACTCCTACGAGAATGTGCTCGTCTGCAAGCCCAGCACCCCCGAGTCA GGTGTCGAGGACTTTGAGGATTACCAGAACTCAGTATCCATCCATCAGTGGCGAGAGTCCAAGAGGACTA TGGGTGCACCAATGTCCCTATCAGGAAGCCCAGATGAGGAGCCAGACTATGTGAATGGGGATGTGGCCGC AGCAGAGAACATCTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_022964 |
Insert Size | 576 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_022964.4, NP_075253.2 |
RefSeq Size | 1636 bp |
RefSeq ORF | 576 bp |
Locus ID | 56743 |
UniProt ID | Q9JHL0 |
Gene Summary | Involved in FCER1 (high affinity immunoglobulin epsilon receptor)-mediated signaling in mast cells. May also be involved in BCR (B-cell antigen receptor)-mediated signaling in B-cells and FCGR1 (high affinity immunoglobulin gamma Fc receptor I)-mediated signaling in myeloid cells. Couples activation of these receptors and their associated kinases with distal intracellular events through the recruitment of GRB2.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) lacks an alternate in-frame exon in the 5' coding region, compared to variant 1. It encodes isoform b, which is shorter than isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG201826 | Lat2 (tGFP-tagged) - Mouse linker for activation of T cells family, member 2 (Lat2), transcript variant 2 |
CNY 2,850.00 |
|
MR201826 | Lat2 (Myc-DDK-tagged) - Mouse linker for activation of T cells family, member 2 (Lat2), transcript variant 2 |
CNY 2,400.00 |
|
MR201826L3 | Lenti ORF clone of Lat2 (Myc-DDK-tagged) - Mouse linker for activation of T cells family, member 2 (Lat2), transcript variant 2 |
CNY 4,750.00 |
|
MR201826L4 | Lenti ORF clone of Lat2 (mGFP-tagged) - Mouse linker for activation of T cells family, member 2 (Lat2), transcript variant 2 |
CNY 4,750.00 |