Sox2 (NM_011443) Mouse Untagged Clone
CAT#: MC207403
Sox2 (untagged) - Mouse SRY-box containing gene 2 (Sox2), (10ug)
CNY 3,600.00
Cited in 1 publication. |
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | lc; lcc; Sox; Sox-2; ys; ysb |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC207403 representing NM_011443
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTATAACATGATGGAGACGGAGCTGAAGCCGCCGGGCCCGCAGCAAGCTTCGGGGGGCGGCGGCGGAG GAGGCAACGCCACGGCGGCGGCGACCGGCGGCAACCAGAAGAACAGCCCGGACCGCGTCAAGAGGCCCAT GAACGCCTTCATGGTATGGTCCCGGGGGCAGCGGCGTAAGATGGCCCAGGAGAACCCCAAGATGCACAAC TCGGAGATCAGCAAGCGCCTGGGCGCGGAGTGGAAACTTTTGTCCGAGACCGAGAAGCGGCCGTTCATCG ACGAGGCCAAGCGGCTGCGCGCTCTGCACATGAAGGAGCACCCGGATTATAAATACCGGCCGCGGCGGAA AACCAAGACGCTCATGAAGAAGGATAAGTACACGCTTCCCGGAGGCTTGCTGGCCCCCGGCGGGAACAGC ATGGCGAGCGGGGTTGGGGTGGGCGCCGGCCTGGGTGCGGGCGTGAACCAGCGCATGGACAGCTACGCGC ACATGAACGGCTGGAGCAACGGCAGCTACAGCATGATGCAGGAGCAGCTGGGCTACCCGCAGCACCCGGG CCTCAACGCTCACGGCGCGGCACAGATGCAACCGATGCACCGCTACGACGTCAGCGCCCTGCAGTACAAC TCCATGACCAGCTCGCAGACCTACATGAACGGCTCGCCCACCTACAGCATGTCCTACTCGCAGCAGGGCA CCCCCGGTATGGCGCTGGGCTCCATGGGCTCTGTGGTCAAGTCCGAGGCCAGCTCCAGCCCCCCCGTGGT TACCTCTTCCTCCCACTCCAGGGCGCCCTGCCAGGCCGGGGACCTCCGGGACATGATCAGCATGTACCTC CCCGGCGCCGAGGTGCCGGAGCCCGCTGCGCCCAGTAGACTGCACATGGCCCAGCACTACCAGAGCGGCC CGGTGCCCGGCACGGCCATTAACGGCACACTGCCCCTGTCGCACATGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Chromatograms |
CHROMATOGRAMS
Sequencher program is needed, download here. |
Restriction Sites | SgfI-MluI |
ACCN | NM_011443 |
Insert Size | 960 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC057574, AAH57574 |
RefSeq Size | 2457 bp |
RefSeq ORF | 960 bp |
Locus ID | 20674 |
UniProt ID | P48432 |
Gene Summary | This intronless gene encodes a member of the SRY-related HMG-box (SOX) family of transcription factors involved in the regulation of embryonic development and in the determination of cell fate. The product of this gene is required for stem-cell maintenance in the central nervous system, and also regulates gene expression in the stomach. Mutations in a similar gene in human have been associated with optic nerve hypoplasia and with syndromic microphthalmia, a severe form of structural eye malformation. This gene lies within an intron of another gene called SOX2 overlapping transcript (Sox2ot). [provided by RefSeq, Sep 2015] |
Citations (1)
The use of this cDNA Clones has been cited in the following citations: |
---|
Matrix softness regulates plasticity of tumour-repopulating cells via H3K9 demethylation and Sox2 expression
,Tan, Y;Tajik, A;Chen, J;Jia, Q;Chowdhury, F;Wang, L;Chen, J;Zhang, S;Hong, Y;Yi, H;Wu, DC;Zhang, Y;Wei, F;Poh, YC;Seong, J;Singh, R;Lin, LJ;Doganay, S;Li, Y;Jia, H;Ha, T;Wang, Y;Huang, B;Wang, N;,
Nat Commun
,PubMed ID 25099074
[Sox2]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG204615 | Sox2 (tGFP-tagged) - Mouse SRY-box containing gene 2 (Sox2) |
CNY 5,200.00 |
|
MR204615 | Sox2 (Myc-DDK-tagged) - Mouse SRY-box containing gene 2 (Sox2) |
CNY 3,600.00 |
|
MR204615L3 | Lenti ORF clone of Sox2 (Myc-DDK-tagged) - Mouse SRY-box containing gene 2 (Sox2) |
CNY 6,000.00 |
|
MR204615L4 | Lenti ORF clone of Sox2 (mGFP-tagged) - Mouse SRY-box containing gene 2 (Sox2) |
CNY 6,000.00 |