Snca (NM_001042451) Mouse Untagged Clone

CAT#: MC207399

Snca (untagged) - Mouse synuclein, alpha (Snca), transcript variant 1, (10ug)



  "NM_001042451" in other vectors (5)

CNY 1,800.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (2)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms alpha-Syn; alphaSYN; NACP
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC207399 representing NM_001042451
Red=Cloning site Blue=ORF

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGATGTGTTCATGAAAGGACTTTCAAAGGCCAAGGAGGGAGTTGTGGCTGCTGCTGAGAAAACCAAGC
AGGGTGTGGCAGAGGCAGCTGGAAAGACAAAAGAGGGAGTCCTCTATGTAGGTTCCAAAACTAAGGAAGG
AGTGGTTCATGGAGTGACAACAGTGGCTGAGAAGACCAAAGAGCAAGTGACAAATGTTGGAGGAGCAGTG
GTGACTGGTGTGACAGCAGTCGCTCAGAAGACAGTGGAGGGAGCTGGGAATATAGCTGCTGCCACTGGCT
TTGTCAAGAAGGACCAGATGGGCAAGGGTGAGGAGGGGTACCCACAGGAAGGAATCCTGGAAGACATGCC
TGTGGATCCTGGCAGTGAGGCTTATGAAATGCCTTCAGAGGAAGGCTACCAAGACTATGAGCCTGAAGCC
TAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001042451
Insert Size 423 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC046764, AAH46764
RefSeq Size 1047 bp
RefSeq ORF 423 bp
Locus ID 20617
UniProt ID O55042
Gene Summary Neuronal protein that plays several roles in synaptic activity such as regulation of synaptic vesicle trafficking and subsequent neurotransmitter release. Participates as a monomer in synaptic vesicle exocytosis by enhancing vesicle priming, fusion and dilation of exocytotic fusion pores. Mechanistically, acts by increasing local Ca(2+) release from microdomains which is essential for the enhancement of ATP-induced exocytosis. Acts also as a molecular chaperone in its multimeric membrane-bound state, assisting in the folding of synaptic fusion components called SNAREs (Soluble NSF Attachment Protein REceptors) at presynaptic plasma membrane in conjunction with cysteine string protein-alpha/DNAJC5 (PubMed:20798282, PubMed:25246573). This chaperone activity is important to sustain normal SNARE-complex assembly during aging. Plays also a role in the regulation of the dopamine neurotransmission by associating with the dopamine transporter (DAT1) and thereby modulating its activity (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longer transcript. Variants 1 and 2 encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...