Mif (NM_010798) Mouse Untagged Clone
CAT#: MC207328
Mif (untagged) - Mouse macrophage migration inhibitory factor (Mif), (10ug)
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | GIF; Glif |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC207328 representing NM_010798
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGCCTATGTTCATCGTGAACACCAATGTTCCCCGCGCCTCCGTGCCAGAGGGGTTTCTGTCGGAGCTCA CCCAGCAGCTGGCGCAGGCCACCGGCAAGCCCGCACAGTACATCGCAGTGCACGTGGTCCCGGACCAGCT CATGACTTTTAGCGGCACGAACGATCCCTGCGCCCTCTGCAGCCTGCACAGCATCGGCAAGATCGGTGGT GCCCAGAACCGCAACTACAGTAAGCTGCTGTGTGGCCTGCTGTCCGATCGCCTGCACATCAGCCCGGACC GGGTCTACATCAACTATTACGACATGAACGCTGCCAACGTGGGCTGGAACGGTTCCACCTTCGCTTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_010798 |
Insert Size | 348 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_010798.2, NP_034928.1 |
RefSeq Size | 554 bp |
RefSeq ORF | 348 bp |
Locus ID | 17319 |
UniProt ID | P34884 |
Gene Summary | Pro-inflammatory cytokine. Involved in the innate immune response to bacterial pathogens. The expression of MIF at sites of inflammation suggests a role as mediator in regulating the function of macrophages in host defense. Counteracts the anti-inflammatory activity of glucocorticoids. Has phenylpyruvate tautomerase and dopachrome tautomerase activity (in vitro), but the physiological substrate is not known. It is not clear whether the tautomerase activity has any physiological relevance, and whether it is important for cytokine activity (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MR200478 | Mif (Myc-DDK-tagged) - Mouse macrophage migration inhibitory factor (Mif) |
CNY 1,200.00 |
|
MR200478L3 | Lenti ORF clone of Mif (Myc-DDK-tagged) - Mouse macrophage migration inhibitory factor (Mif) |
CNY 4,750.00 |
|
MR200478L4 | Lenti ORF clone of Mif (mGFP-tagged) - Mouse macrophage migration inhibitory factor (Mif) |
CNY 3,600.00 |