Fgf12 (NM_010199) Mouse Untagged Clone
CAT#: MC207274
Fgf12 (untagged) - Mouse fibroblast growth factor 12 (Fgf12), transcript variant 2, (10ug)
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | AV114868; B230343J05Rik; FGF-12; FHF-1; Fhf1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC207274 representing NM_010199
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGAGAGCAAAGAACCCCAGCTGAAAGGGATTGTGACAAGGTTATTCAGCCAGCAGGGATATTTCCTGC AGATGCATCCAGATGGTACCATTGATGGGACCAAGGACGAAAACAGCGACTACACCCTCTTCAATCTAAT TCCTGTAGGACTGCGTGTGGTGGCCATCCAAGGGGTTAAAGCCAGCCTTTATGTGGCCATGAATGGAGAA GGCTATCTCTACAGCTCAGATGTTTTTACCCCAGAATGCAAATTTAAGGAGTCTGTGTTTGAAAACTACT ATGTGATCTATTCCTCAACCCTGTATCGCCAGCAGGAATCAGGCCGTGCATGGTTTCTAGGACTCAATAA AGAAGGTCAAATCATGAAGGGGAACAGAGTGAAGAAAACCAAGCCCTCATCTCATTTTGTACCAAAACCT ATTGAAGTGTGTATGTACAGAGAACCATCACTACACGAAATTGGAGAAAAGCAAGGACGCTCAAGGAAAA GTTCGGGAACACCCACCATGAATGGAGGCAAAGTCGTGAATCAAGATTCTACATAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_010199 |
Insert Size | 546 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_010199.4, NP_034329.1 |
RefSeq Size | 5408 bp |
RefSeq ORF | 546 bp |
Locus ID | 14167 |
UniProt ID | P61329 |
Gene Summary | Involved in nervous system development and function. Promote neuronal excitability by elevating the voltage dependence of neuronal sodium channel SCN8A fast inactivation.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) uses an alternate 5' exon structure, differs in the 5' UTR and initiates translation at an alternate start codon, compared to variant 1. It encodes isoform b which is shorter and has a distinct N-terminus, compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG201628 | Fgf12 (tGFP-tagged) - Mouse fibroblast growth factor 12 (Fgf12), transcript variant 2 |
CNY 2,850.00 |
|
MR201628 | Fgf12 (Myc-DDK-tagged) - Mouse fibroblast growth factor 12 (Fgf12), transcript variant 2 |
CNY 2,400.00 |
|
MR201628L3 | Lenti ORF clone of Fgf12 (Myc-DDK-tagged) - Mouse fibroblast growth factor 12 (Fgf12), transcript variant 2 |
CNY 4,750.00 |
|
MR201628L4 | Lenti ORF clone of Fgf12 (mGFP-tagged) - Mouse fibroblast growth factor 12 (Fgf12), transcript variant 2 |
CNY 4,750.00 |