Gtf2a2 (BC048705) Mouse Untagged Clone
CAT#: MC207177
Gtf2a2 (untagged) - Mouse general transcription factor II A, 2 (cDNA clone MGC:59444 IMAGE:6505667), (10ug)
CNY 3,230.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 12kDa, TfIIg |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC048705
Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCCTATCAGTTATACAGAAATACAACTTTGGGGAACAGTCTTCAAGAGAGCCTTGATGAGCTCATAC AGTCTCAACAGATCACCCCCCAGCTTGCGCTTCAAGTTCTACTTCAGTTTGATAAAGCTATAAATTCAGC ATTGGCTCAGAGAGTCAGGAACAGAGTCAATTTCAGGGTAAGGATGTCTTCCTGCATCTGGAAGTCTGTA CTGCTAACTCTGAGAGCGTACGTGGACTTAACTCACCATAGCAAGATTTGGTTAGTCTGGTTTGGGAACT TGTTCTATAATCGTTGTGCTAAGTTCATCCATTCCATGTGTTTCAGAATTGCTTTTAGATTTTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | BC048705 |
Insert Size | 345 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC048705, AAH48705 |
RefSeq Size | 1124 bp |
RefSeq ORF | 344 bp |
Locus ID | 235459 |
Gene Summary | TFIIA is a component of the transcription machinery of RNA polymerase II and plays an important role in transcriptional activation. TFIIA in a complex with TBP mediates transcriptional activity (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG200471 | Gtf2a2 (tGFP-tagged) - Mouse general transcription factor II A, 2 (cDNA clone MGC:59444 IMAGE:6505667) |
CNY 2,850.00 |
|
MR200471 | Gtf2a2 (Myc-DDK-tagged) - Mouse general transcription factor II A, 2 (cDNA clone MGC:59444 IMAGE:6505667) |
CNY 1,200.00 |
|
MR200471L3 | Lenti ORF clone of Gtf2a2 (Myc-DDK-tagged) - Mouse general transcription factor II A, 2 (cDNA clone MGC:59444 IMAGE:6505667) |
CNY 4,750.00 |
|
MR200471L4 | Lenti ORF clone of Gtf2a2 (mGFP-tagged) - Mouse general transcription factor II A, 2 (cDNA clone MGC:59444 IMAGE:6505667) |
CNY 4,750.00 |