Eif3s12 (BC027638) Mouse Untagged Clone
CAT#: MC207136
Eif3s12 (untagged) - Mouse eukaryotic translation initiation factor 3, subunit 12 (cDNA clone MGC:41262 IMAGE:1348838), (10ug)
CNY 3,230.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | eIF3K |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC027638
Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCGATGTTTGAGCAGATGAGAGCGAACGTGGGCAAGTTGCTCAAGGGTATCGACAGGTACCAGTTCA ACCCAGCCTTCTTCCAGACCACAGTCACTGCCCAGATTCTGCTGAAAGCCCTCACCAACCTGCCCCACAC CGACTTCACTCTGTGTAAATGTATGATCGACCAGGCACATCAAGAAGAGCGGCCCATCCGGCAGATCTTG TACCTCGGGGACCTGCTGGAGACCTGCCACTTTCAAGCCTTCTGGCAAGCCCTGGATGAGAACATGGACC TTCTGGAAGGCATAACTGGCTTTGAAGACTCTGTCCGAAAATTTATCTGCCACGTGGTGGGCATCACGTA CCAGCACATCGACCGCTGGCTGCTGGCCGAGATGCTCGGAGACCTGACTGACAACCAGCTGAAGGTGTGG ATGAGCAAGTACGGCTGGAGCGCTGACGAGTCAGGGCAGGTCTTCATCTGCAGCCAGGAAGAGAGCATTA AGCCCAAGAACATCGTGGAGAAGATTGACTTTGACAGTGTGTCCAGCATCATGGCCTCCTCCCAGTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | BC027638 |
Insert Size | 558 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC027638, AAH27638 |
RefSeq Size | 670 bp |
RefSeq ORF | 557 bp |
Locus ID | 73830 |
Gene Summary | Component of the eukaryotic translation initiation factor 3 (eIF-3) complex, which is required for several steps in the initiation of protein synthesis. The eIF-3 complex associates with the 40S ribosome and facilitates the recruitment of eIF-1, eIF-1A, eIF-2:GTP:methionyl-tRNAi and eIF-5 to form the 43S pre-initiation complex (43S PIC). The eIF-3 complex stimulates mRNA recruitment to the 43S PIC and scanning of the mRNA for AUG recognition. The eIF-3 complex is also required for disassembly and recycling of post-termination ribosomal complexes and subsequently prevents premature joining of the 40S and 60S ribosomal subunits prior to initiation. The eIF-3 complex specifically targets and initiates translation of a subset of mRNAs involved in cell proliferation, including cell cycling, differentiation and apoptosis, and uses different modes of RNA stem-loop binding to exert either translational activation or repression.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG201715 | Eif3s12 (tGFP-tagged) - Mouse eukaryotic translation initiation factor 3, subunit 12 (cDNA clone MGC:41262 IMAGE:1348838) |
CNY 2,090.00 |
|
MR201715 | Eif3s12 (Myc-DDK-tagged) - Mouse eukaryotic translation initiation factor 3, subunit 12 (cDNA clone MGC:41262 IMAGE:1348838) |
CNY 1,900.00 |
|
MR201715L3 | Lenti ORF clone of Eif3s12 (Myc-DDK-tagged) - Mouse eukaryotic translation initiation factor 3, subunit 12 (cDNA clone MGC:41262 IMAGE:1348838) |
CNY 3,800.00 |
|
MR201715L4 | Lenti ORF clone of Eif3s12 (mGFP-tagged) - Mouse eukaryotic translation initiation factor 3, subunit 12 (cDNA clone MGC:41262 IMAGE:1348838) |
CNY 3,800.00 |
其它Eif3s12产品