Dnajc19 (BC024335) Mouse Untagged Clone
CAT#: MC207103
Dnajc19 (untagged) - Mouse DnaJ (Hsp40) homolog, subfamily C, member 19 (cDNA clone MGC:35659 IMAGE:4974988), (10ug)
CNY 3,230.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 1810055D05Rik; AA959924; Tim14 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC024335
Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCCAGCACAGTGGTAGCAGTCGGGTTGACCATTGCTGCTGCAGGATTTGCAGGCCGTTATGTTTTAC AAGCCATGAAGCATGTGGAGCCTCAAGTAAAACAAGTTTTTCAGAGCCTACCAAAATCTGCATTCGGTGG TGGGTACTACAGAGGTGGATTTGAACCCAAAATGACAAAACGGGAAGCAGCATTAATATTAGGTGTAAGC CCTACTGCCAATAAAGGGAAGATCAGGGATGCTCATCGCCGGATTATGCTATTAAATCACCCAGACAAGG GTAAGCAACTTTTATTACTATACTGGACTGTTAATGGAATAGCTAATTCTTGGTGTTATGAATGTCTGTG TGTGAGCAGTTTCCCAGTTGTGGATCACATTGTAGTGTCTTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | BC024335 |
Insert Size | 393 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC024335, AAH24335 |
RefSeq Size | 1716 bp |
RefSeq ORF | 392 bp |
Locus ID | 67713 |
Gene Summary | Probable component of the PAM complex, a complex required for the translocation of transit peptide-containing proteins from the inner membrane into the mitochondrial matrix in an ATP-dependent manner. May act as a co-chaperone that stimulate the ATP-dependent activity (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG200742 | Dnajc19 (tGFP-tagged) - Mouse DnaJ (Hsp40) homolog, subfamily C, member 19 (cDNA clone MGC:35659 IMAGE:4974988) |
CNY 2,850.00 |
|
MR200742 | Dnajc19 (Myc-DDK-tagged) - Mouse DnaJ (Hsp40) homolog, subfamily C, member 19 (cDNA clone MGC:35659 IMAGE:4974988) |
CNY 1,200.00 |
|
MR200742L3 | Lenti ORF clone of Dnajc19 (Myc-DDK-tagged) - Mouse DnaJ (Hsp40) homolog, subfamily C, member 19 (cDNA clone MGC:35659 IMAGE:4974988) |
CNY 4,750.00 |
|
MR200742L4 | Lenti ORF clone of Dnajc19 (mGFP-tagged) - Mouse DnaJ (Hsp40) homolog, subfamily C, member 19 (cDNA clone MGC:35659 IMAGE:4974988) |
CNY 4,750.00 |
其它Dnajc19产品