Sip1 (BC053424) Mouse Untagged Clone
CAT#: MC207094
Sip1 (untagged) - Mouse survivor of motor neuron protein interacting protein 1 (cDNA clone MGC:59266 IMAGE:6336522), (10ug)
CNY 3,230.00
Cited in 2 publications. |
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | Gemin2 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC053424
Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTATGTATTACTTAATTGTAGGATCGAAGCAGCCCAATGTCCAGATGTTGTGGTAGCCCAGATTGACC CAAAGAAGTTGAAAAGGAAGCAAAGTGTGAACATTTCTGTTCAGAGATTCAGTCCATTATCATCAAGGTG GGAGCATGGCAGTATCCAGGCAGGCTTGGCACAGGAGGAACTGAGAGTTCTACATCTTCATCCAAAGGCT GCTAGTGGAAGACTGACTCCCAGGCAACTAGGCTTTCCGGATGCCAGCCTGCGCCTGAAGGTTACTCTCC AACACTTCAGTGGCAACAACAACAAGTGGCACATTTTTCAACTGTTCGACAGAGTGTACACAAGCATAGA AATCACTGGAAATCACAACAGTTGGACAGTAATGTGGCAATGCCAAAATCTGAAGATGAAGAAGGCTGGA AAAAATTTTGTCTGGGTGAAAGGTTATGTGCTGAAGGGGCCACTGGACCGTCTACAGAGGAAAGCCCTGG GATCGATTATGTACAAGTTGGTTTTCCTCCTTTGCTTAGTATTGTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | BC053424 |
Insert Size | 537 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC053424, AAH53424 |
RefSeq Size | 2064 bp |
RefSeq ORF | 536 bp |
Locus ID | 66603 |
Gene Summary | This gene encodes one of the proteins found in the survival of motor neuron (SMN) complex, which consists of the SMN protein and several gemin proteins. The SMN complex is localized to a subnuclear compartment called gems (gemini of coiled bodies) and is required for assembly of spliceosomal small nuclear ribonucleoproteins (snRNP) and for pre-mRNA splicing. This protein interacts directly with the SMN protein and it is required for formation of the SMN complex. Disruption of this gene in mouse resulted in impaired snRNP assembly, and motor neuron degeneration. [provided by RefSeq, Sep 2015] |
Citations (2)
The use of this cDNA Clones has been cited in the following citations: |
---|
BMP and TGF-? pathway mediators are critical upstream regulators of Wnt signaling during midbrain dopamine differentiation in human pluripotent stem cells
,null,
Developmental biology
,PubMed ID 23352789
[Sip1]
|
SIP1 is downregulated in hepatocellular carcinoma by promoter hypermethylation
,null,
BMC Cancer
,PubMed ID 21645397
[Sip1]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG201583 | Sip1 (tGFP-tagged) - Mouse survivor of motor neuron protein interacting protein 1 (cDNA clone MGC:59266 IMAGE:6336522) |
CNY 2,850.00 |
|
MR201583 | Sip1 (Myc-DDK-tagged) - Mouse survivor of motor neuron protein interacting protein 1 (cDNA clone MGC:59266 IMAGE:6336522) |
CNY 2,400.00 |
|
MR201583L3 | Lenti ORF clone of Sip1 (Myc-DDK-tagged) - Mouse survivor of motor neuron protein interacting protein 1 (cDNA clone MGC:59266 IMAGE:6336522) |
CNY 4,750.00 |
|
MR201583L4 | Lenti ORF clone of Sip1 (mGFP-tagged) - Mouse survivor of motor neuron protein interacting protein 1 (cDNA clone MGC:59266 IMAGE:6336522) |
CNY 4,750.00 |