United States
Germany
Japan
United Kingdom
China
Sct (BC048484) Mouse Untagged Clone
CAT＃: MC207072
Sct (untagged) - Mouse secretin (cDNA clone MGC:58269 IMAGE:6707701), (10ug)
CNY 3,230.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>BC048484
Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGAGCCTCCGCTGCCCACGCCGATGCTACTGCTGTTGCTGCTGCTGCTCTCCAGTTCCGCCGCGCTCC CTGCACCTCCCAGGACCCCAAGACACTCAGACGGAATGTTCACCAGCGAGCTCAGCCGCTTGCAGGACAG TGCCAGGCTGCAGCGCCTGCTGCAGGGTCTGGTGGGGAAGCGCAGCGAGCAGGACACAGAAAATATCCCA GAGAACAGCCTGGCCCGGTCCAAGCCCTTAGAGGACCAGCTCTGCTTGCTGTGGTCGAACACTCAGACCC TACAGGACTGTCCCCTCTCCTTCCACAGGCTTCTGCCCAGGCTGTCCCTGGATGGGTCCCTGTCTCTCTG GCTGCCTCCTGGACCAAGGTCTGCTGTTGATCGTTCAGAGTGGACTGAAACAACCAGGCCACCCAGATGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | BC048484 |
| Insert Size | 420 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC048484, AAH48484 |
| RefSeq Size | 564 bp |
| RefSeq ORF | 419 bp |
| Locus ID | 20287 |
| Gene Summary | This gene encodes the precursor of a gastrointestinal peptide hormone of the secretin-glucagon family. The encoded protein is secreted as a prohormone that undergoes proteolytic processing to generate a mature peptide hormone. The mature peptide regulates secretion of gastric acid, biocarbonate ions from pancreatic and biliary duct epithelia and water homeostasis in the gastrointestinal system. Mice lacking the encoded protein display decreased survival of neuroprogenitor cells during early postnatal period and impaired long-term potentiation and spatial learning in adulthood. Alternative splicing results in multiple transcript variants encoding different isoforms. All of these isoforms may be processed in a similar manner to generate the mature peptide hormone. [provided by RefSeq, Jul 2015] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG200869 | Sct (tGFP-tagged) - Mouse secretin (cDNA clone MGC:58269 IMAGE:6707701) |
CNY 2,090.00 |
|
| MR200869 | Sct (Myc-DDK-tagged) - Mouse secretin (cDNA clone MGC:58269 IMAGE:6707701) |
CNY 1,900.00 |
|
| MR200869L3 | Lenti ORF clone of Sct (Myc-DDK-tagged) - Mouse secretin (cDNA clone MGC:58269 IMAGE:6707701) |
CNY 3,800.00 |
|
| MR200869L4 | Lenti ORF clone of Sct (mGFP-tagged) - Mouse secretin (cDNA clone MGC:58269 IMAGE:6707701) |
CNY 3,800.00 |
