Fxyd5 (BC031112) Mouse Untagged Clone
CAT#: MC207063
Fxyd5 (untagged) - Mouse FXYD domain-containing ion transport regulator 5 (cDNA clone MGC:35841 IMAGE:4977085), (10ug)
CN¥ 2,400.00
CN¥ 3,230.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | RIC, EF-8 |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for BC031112, the custom clone sequence may differ by one or more nucleotides
ATGTCACTGTCCAGTCGCCTGTGTCTCCTCACTATTGTCGCCCTGATTCTGCCCAGCAGAGGGCAGACAC CAAAAAAGCCCACATCCATTTTTACAGCGGACCAGACTTCTGCGACTACTCGTGACAATGTCCCAGATCC AGATCAAACCAGCCCAGGAGTCCAGACCACCCCTCTCATCTGGACCAGAGAAGCAGAAGCCACAGGAAGC CAGACAGCAGCCCAAACCGAGACCCAGCAACTGACAAAAATGGCCACCTCGAATCCAGTGTCAGATCCAG GGCCACATACAAGCAGCAAGAAAGGTACCCCTGCAGTCTCCAGGATCGAGCCTCTCAGCCCATCCAAAAA CTTCATGCCTCCATCCTACATTGAACATCCACTGGATTCGAATGAGAACAACCCCTTCTACTACGATGAT ACTACCCTCCGGAAACGGGGACTGCTGGTGGCTGCGGTGCTGTTCATCACGGGAATTATCATTCTCACTA GTGAGAGTCGGGCATGGGCAGAAAGGGCAAGAAGGGGCTGGGGGCGGGCTGGGCTGCATGGTGACTGA |
Restriction Sites | SgfI-MluI |
ACCN | BC031112 |
Insert Size | 963 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC031112 |
RefSeq Size | 2995 bp |
RefSeq ORF | 963 bp |
Locus ID | 18301 |
Gene Summary | This gene encodes a precursor protein that is member of the FXYD family of transmembrane glycoproteins. Like most members of the FXYD family, the encoded protein is a subunit of the sodium-potassium adenosine triphosphatase pump. FXYD family members have tissue-specific expression and differentially regulate the activity of this pump. The protein encoded by this gene also plays a role in cell adhesion and motility. The orthologous human protein inhibits epithelial cadherin, a calcium-dependent adhesion protein and is associated with cancer (promotes metastasis). Alternative splicing of this mouse gene results in multiple transcript variants. [provided by RefSeq, Dec 2013] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG201722 | Fxyd5 (tGFP-tagged) - Mouse FXYD domain-containing ion transport regulator 5 (cDNA clone MGC:35841 IMAGE:4977085) |
CN¥ 2,850.00 |
|
MR201722 | Fxyd5 (Myc-DDK-tagged) - Mouse FXYD domain-containing ion transport regulator 5 (cDNA clone MGC:35841 IMAGE:4977085) |
CN¥ 2,400.00 |
|
MR201722L3 | Lenti ORF clone of Fxyd5 (Myc-DDK-tagged) - Mouse FXYD domain-containing ion transport regulator 5 (cDNA clone MGC:35841 IMAGE:4977085) |
CN¥ 4,750.00 |
|
MR201722L4 | Lenti ORF clone of Fxyd5 (mGFP-tagged) - Mouse FXYD domain-containing ion transport regulator 5 (cDNA clone MGC:35841 IMAGE:4977085) |
CN¥ 4,750.00 |