Myl1 (BC059087) Mouse Untagged Clone

CAT#: MC207061

Myl1 (untagged) - Mouse myosin, light polypeptide 1 (cDNA clone MGC:70067 IMAGE:30139109), (10ug)



  "BC059087" in other vectors (4)

CNY 3,230.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms MLC1f, MLC3f
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC059087
Red=Cloning site Blue=ORF Green=Tags(s)

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTCCTTCAGTGCTGACCAGATTGCCGACTTCAAGGAGGCATTTCTCCTGTTTGACAGAACAGGTGAAT
GCAAGATCACCTTAAGTCAGGTGGGAGACGTCCTCCGGGCTCTGGGCACCAATCCCACCAATGCAGAGGT
CAAGAAGGTTCTTGGGAACCCCAGCAATGAAGAGATGAATGCTAAGAAAATCGAGTTTGAACAGTTTCTG
CCCATGATGCAAGCTATCTCCAACAACAAGGACCAGGGAGGTTATGAAGATTTCGTTGAGGGTCTGCGTG
TCTTCGACAAGGAGGGCAATGGCACCGTCATGGGTGCTGAACTCCGCCATGTCCTCGCCACTCTGGGAGA
GAAGATGAAGGAGGAAGAGGTAGAAGCGTTGCTGGCAGGCCAGGAGGACTCCAATGGCTGCATCAACTAT
GAAGGTACAGCCAGCCTCACCTCATTAAGGAGAGATTCATTTTCAACTTTATTTTCCTCTTCTCTATTGA
CATATATGACTTATTATAAATAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAG
GTTTAA
Restriction Sites SgfI-MluI     
ACCN BC059087
Insert Size 513 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC059087, AAH59087
RefSeq Size 649 bp
RefSeq ORF 512 bp
Locus ID 17901
Gene Summary Myosin is a hexameric ATPase cellular motor protein. It is composed of two heavy chains, two non-phosphorylatable alkali light chains, and two phosphorylatable regulatory light chains. This gene encodes a myosin alkali light chain expressed in fast skeletal muscle. Multiple transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...