Tmigd3 (NM_001174169) Mouse Untagged Clone
CAT#: MC207048
Adora3 (untagged) - Mouse adenosine A3 receptor (Adora3), transcript variant 3, (10ug)
CNY 3,230.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 1700001d09rik; 4930578J19Rik |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC207048 representing NM_001174169
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTTTGGCTGGAATAGAAAAGCAACCTTAGCGAGCTCTCAAAATAGCAGCACTCTTTTGTGCCACTTCC GTTCCGTGGTCAGTTTGGATTACATGGTCTTCTTCAGCTTCGTCACCTGGATCCTCGTCCCCCTGGTTGT CATGTGTGTCATCTACCTAGACATCTTCTACATCATCCGAAATAAGCTCAGTCAAAACCTGTCTGGCTTC AGAGAGACGCGTGCATTTTATGGACGGGAGTTCAAGACAGCTAAGTCCCTGTTTCTGGTTCTCTTCTTGT TTGCGCTGTGCTGGCTGCCTTTGTCCATCATCAATTTTGTTTCCTATTTTGATGTAAAGATACCAGATGT CGCAATGTGCCTGGGGATCCTGTTGTCCCACGCGAACTCCATGATGAACCCTATTGTCTACGCCTGCAAA ATAAAAAAGTTCAAAGAGACCTACTTTCTGATCCTCAGAGCTCTCAGGCTCTGTCAGACCTCAGATTCTT TGGACTCAAACATGGAACAGACTACTGAGTAA AGCGGACCGACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCC TGGATTACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-RsrII |
ACCN | NM_001174169 |
Insert Size | 522 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001174169.2, NP_001167640.1 |
RefSeq Size | 1794 bp |
RefSeq ORF | 522 bp |
Locus ID | 69296 |
Gene Summary | This gene encodes a transmembrane and immunoglobulin domain-containing protein. Alternative splicing results in multiple transcript variants, one of which shares its 3' terminal exon with that of the overlapping adenosine A3 receptor gene (GeneID:11542). [provided by RefSeq, Nov 2014] Transcript Variant: This variant (3) includes the same 5' terminal exon but lacks the remaining exons and instead includes an alternate 3' terminal exon, compared to variant 2. The 3' terminal exon is shared with that of the adenosine A3 receptor gene. The encoded isoform (3), which is shorter and distinct compared to isoform 2, represents the C-terminal region of the adenosine A3 receptor. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MR201495 | Adora3 (Myc-DDK-tagged) - Mouse adenosine A3 receptor (Adora3), transcript variant 3 |
CNY 3,600.00 |
|
MR201495L3 | Lenti ORF clone of Adora3 (Myc-DDK-tagged) - Mouse adenosine A3 receptor (Adora3), transcript variant 3 |
CNY 4,750.00 |
|
MR201495L4 | Lenti ORF clone of Adora3 (mGFP-tagged) - Mouse adenosine A3 receptor (Adora3), transcript variant 3 |
CNY 4,750.00 |