United States
Germany
Japan
United Kingdom
China
Ypel5 (BC025125) Mouse Untagged Clone
CAT＃: MC207002
Ypel5 (untagged) - Mouse yippee-like 5 (Drosophila) (cDNA clone MGC:36888 IMAGE:4921751), (10ug)
CNY 3,230.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | 2310076K21Rik; CGI-127 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC207002 representing BC025125.
Blue=ORF Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGCTCACTGGCCGCCACATGGTTCGAGATGTGAGCTGCAAAAACTGCAATAGCAAACTGGGATGGATC TATGAGTTTGCTACTGAAGACAGCCAGCGTTATAAGGAAGGCCGTGTGATCCTGGAACGTGCACTAGTT CGAGAGAGCGAAGGCTTTGAAGAGCATGTACCATCTGATAACTCTTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | BC025125 |
| Insert Size | 186 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC025125 |
| RefSeq Size | 976 bp |
| RefSeq ORF | 185 bp |
| Locus ID | 383295 |
| MW | 7.1 kDa |
| Gene Summary | Component of the CTLH E3 ubiquitin-protein ligase complex that selectively accepts ubiquitin from UBE2H and mediates ubiquitination and subsequent proteasomal degradation of the transcription factor HBP1 (By similarity). Required for normal cell proliferation (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG200035 | Ypel5 (tGFP-tagged) - Mouse yippee-like 5 (Drosophila) (cDNA clone MGC:36888 IMAGE:4921751) |
CNY 2,850.00 |
|
| MR200035 | Ypel5 (Myc-DDK-tagged) - Mouse yippee-like 5 (Drosophila) (cDNA clone MGC:36888 IMAGE:4921751) |
CNY 1,200.00 |
|
| MR200035L3 | Lenti ORF clone of Ypel5 (Myc-DDK-tagged) - Mouse yippee-like 5 (Drosophila) (cDNA clone MGC:36888 IMAGE:4921751) |
CNY 4,750.00 |
|
| MR200035L4 | Lenti ORF clone of Ypel5 (mGFP-tagged) - Mouse yippee-like 5 (Drosophila) (cDNA clone MGC:36888 IMAGE:4921751) |
CNY 4,750.00 |
