Rps23 (BC002145) Mouse Untagged Clone

CAT#: MC206900

Rps23 (untagged) - Mouse ribosomal protein S23 (cDNA clone MGC:7260 IMAGE:3484753), (10ug)



CNY 3,230.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 2410044J15Rik
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC206900 representing BC002145.
Blue=ORF Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGGCAAGTGTCGTGGTCTCCGAACTGCCCGGAAGCTCCGCAGTCACCGACGGGACCAGAAGTGGCAT
GACAAACAGTACAAGAAAGCCCACTTGGGCACAGCCCTGAAGGCCAATCCGTTTGGGGGTGCCTCTCAT
GCAAAGGGAATTGTGCTGGAAAAAGTAGGGGTTGAGGCCAAACAGCCAAATTCTGCCATCAGGAAGTGC
GTCAGGGTGCAGCTCATTAAGAACGGGAAGAAGATCACAGCGTTCGTGCCCAATGATGGCTGCCTGAAC
TTCATTGAGGAAAATGATGAAGTTCTGGTTGCTGGATTTGGTCGAAAAGGTCATGCTGTAGGTGATATT
CCTGGAGTCCGCTTTAAGGTGGTTAAAGTAGCCAATGTTTCTCTGTTGGCTCTATACAAAGGCAAGAAA
GAAAGGCCAAGATCATAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN BC002145
Insert Size 432 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC002145
RefSeq Size 513 bp
RefSeq ORF 431 bp
Locus ID 66475
MW 15.8 kDa
Gene Summary Component of the ribosome, a large ribonucleoprotein complex responsible for the synthesis of proteins in the cell. The small ribosomal subunit (SSU) binds messenger RNAs (mRNAs) and translates the encoded message by selecting cognate aminoacyl-transfer RNA (tRNA) molecules. The large subunit (LSU) contains the ribosomal catalytic site termed the peptidyl transferase center (PTC), which catalyzes the formation of peptide bonds, thereby polymerizing the amino acids delivered by tRNAs into a polypeptide chain. The nascent polypeptides leave the ribosome through a tunnel in the LSU and interact with protein factors that function in enzymatic processing, targeting, and the membrane insertion of nascent chains at the exit of the ribosomal tunnel. Plays an important role in translational accuracy.[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
Customer Reviews 
Loading...