Cdca8 (BC068181) Mouse Untagged Clone
CAT#: MC206873
Cdca8 (untagged) - Mouse cell division cycle associated 8 (cDNA clone MGC:92981 IMAGE:30634239), (10ug)
CNY 3,230.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | MESRGP, BOR |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC206873 representing BC068181.
Blue=ORF Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCTCCCAAGAAACGCAGCAGCCGCGGAACCAGGACCAACACGCTGCGGAGCCGGAAGCTCGCCTCC TTCCTGAAGGACTTCGACCGCGAGGTGCAAGTTCGAACCAAGCAAATTGAGTCCGACAGACAGACCCTC CTCAAGGAGGTGGAAAATCTGTACAACATCGAGATCCTTCGGCTCCCCAAGGCGCTGCAAGGGATGAAG TGGCTTGACTACTTCGCCCTAGGAGGAAACAAGCAGGCCCTGGAAGAGGCAGCAAAAGCTGATCGAGAC ATCACAGAAATAAACAATTTAACAGCTGAAGCTATTCAGACACCTTTGAAATCTGTTAAAAAGCGAAAG GTAATCGAGGTGGAGGAATCGATAAAGGAAGAAGAAGAACAAAAAAGAGCCATAAGAATCTTCGATCTG CAAAAGTCAAAAGATGCCTTCCATCCAAGAAGAGAACCCAGTCCATACAAGGAAGAGGCAGAAGTAAAA GGTTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | BC068181 |
Insert Size | 489 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC068181 |
RefSeq Size | 1572 bp |
RefSeq ORF | 488 bp |
Locus ID | 52276 |
MW | 18.9 kDa |
Gene Summary | Component of the chromosomal passenger complex (CPC), a complex that acts as a key regulator of mitosis. The CPC complex has essential functions at the centromere in ensuring correct chromosome alignment and segregation and is required for chromatin-induced microtubule stabilization and spindle assembly. In the complex, it may be required to direct the CPC to centromeric DNA. Major effector of the TTK kinase in the control of attachment-error-correction and chromosome alignment (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG201279 | Cdca8 (tGFP-tagged) - Mouse cell division cycle associated 8 (cDNA clone MGC:92981 IMAGE:30634239) |
CNY 2,850.00 |
|
MR201279 | Cdca8 (Myc-DDK-tagged) - Mouse cell division cycle associated 8 (cDNA clone MGC:92981 IMAGE:30634239) |
CNY 1,200.00 |
|
MR201279L3 | Lenti ORF clone of Cdca8 (Myc-DDK-tagged) - Mouse cell division cycle associated 8 (cDNA clone MGC:92981 IMAGE:30634239) |
CNY 4,750.00 |
|
MR201279L4 | Lenti ORF clone of Cdca8 (mGFP-tagged) - Mouse cell division cycle associated 8 (cDNA clone MGC:92981 IMAGE:30634239) |
CNY 4,750.00 |