Ltc4s (BC028760) Mouse Untagged Clone

CAT#: MC206837

Ltc4s (untagged) - Mouse leukotriene C4 synthase (cDNA clone MGC:41203 IMAGE:1348372), (10ug)



  "BC028760" in other vectors (4)

CNY 1,200.00

CNY 3,230.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC206837 representing BC028760.
Blue=ORF Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAAGGACGAAGTGGCTCTTCTGGCTACCGTCACCCTCGTGGGAGTTCTGTTGCAAGCCTACTTCTCC
CTACAGGTGATCTCTGCACGAAGGGCTTTCCACGTGTCGCCGCCGCTCACCTCTGGCCCTCCCGAGTTC
GAGCGCGTCTTCCGAGCCCAGGTAAACTGCAGCGAGTACTTTCCGCTGTTCCTCGCCACACTCTGGGTC
GCCGGCATCTTCTTCCACGAAGGAGCCGCAGCCCTGTGCGGACTGTTCTACCTGTTCGCGCGCCTCCGC
TATTTCCAGGGATACGCGCGCTCAGCGCAACTCAGATGGCTCCAGATGCTCCTGCCGATGGCCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN BC028760
Insert Size 342 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC028760
RefSeq Size 503 bp
RefSeq ORF 341 bp
Locus ID 17001
MW 12.8 kDa
Gene Summary The protein encoded by this gene is an enzyme that catalyzes the synthesis of leukotriene C4 by combining leukotriene A4 with reduced glutathione. The encoded protein is found in the outer nuclear membrane and in the peripheral endoplasmic reticulum. Leukotrienes have been implicated as mediators of anaphylaxis and inflammatory conditions such as bronchial asthma in humans. Several transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...