Hist2h2aa1 (BC062255) Mouse Untagged Clone
CAT#: MC206833
Hist2h2aa1 (untagged) - Mouse histone cluster 2, H2aa1 (cDNA clone MGC:73680 IMAGE:1448126), (10ug)
CNY 3,230.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | AI448581; H2a-614; H2a-615; Hist2 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC206833 representing BC062255.
Blue=ORF Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGTCCGGTCGTGGCAAGCAAGGAGGCAAGGCCCGCGCCAAGGCCAAGTCGCGGTCTTCCCGGGCCGGG CTACAGTTCCCGGTGGGGCGTGTGCACCGGCTGCTGCGCAAGGGCAACTACGCGGAGCGTGTGGGTGCC GGCGCGCCGGTATACATGGCGGCGGTGCTGGAGTACCTAACGGCCGAGATCCTGGAGCTGGCGGGCAAC GCGGCCCGCGACAACAAGAAGACGCGCATCATCCCGCGCCACCTGCAGCTGGCCATCCGCAACGACGAG GAGCTCAACAAGCTGCTGGGCAAAGTGACGATCGCGCAGGGCGGCGTCCTGCCCAACATCCAGGCCGTG CTGCTGCCCAAGAAGACGGAGAGCCACCATAAGGCGAAGGGCAAGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | BC062255 |
Insert Size | 393 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC062255 |
RefSeq Size | 552 bp |
RefSeq ORF | 392 bp |
Locus ID | 15267 |
MW | 14.1 kDa |
Gene Summary | Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene is intronless and encodes a replication-dependent histone that is a member of the histone H2A family. [provided by RefSeq, Oct 2015] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG200740 | Hist2h2aa1 (tGFP-tagged) - Mouse histone cluster 2, H2aa1 (cDNA clone MGC:73680 IMAGE:1448126) |
CNY 2,850.00 |
|
MR200740 | Hist2h2aa1 (Myc-DDK-tagged) - Mouse histone cluster 2, H2aa1 (cDNA clone MGC:73680 IMAGE:1448126) |
CNY 1,200.00 |
|
MR200740L3 | Lenti ORF clone of Hist2h2aa1 (Myc-DDK-tagged) - Mouse histone cluster 2, H2aa1 (cDNA clone MGC:73680 IMAGE:1448126) |
CNY 4,750.00 |
|
MR200740L4 | Lenti ORF clone of Hist2h2aa1 (mGFP-tagged) - Mouse histone cluster 2, H2aa1 (cDNA clone MGC:73680 IMAGE:1448126) |
CNY 4,750.00 |
其它Hist2h2aa1产品