Fabp2 (BC013457) Mouse Untagged Clone

CAT#: MC206794

Fabp2 (untagged) - Mouse fatty acid binding protein 2, intestinal (cDNA clone MGC:18570 IMAGE:4218050), (10ug)



  "BC013457" in other vectors (1)

CN¥ 1,200.00

CN¥ 2,000.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CN¥ 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CN¥ 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CN¥ 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms Fabpi; I-FABP
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC013457
GAGACACACACAGCTGAGATCATGGCATTCGACGGCACGTGGAAAGTAGACCGGAACGAGAACTATGAAA AGTTCATGGAGAAAATGGGCATTAATGTGATGAAGAGGAAGCTTGGAGCTCATGACAATCTGAAACTGAC AATCACACAGGATGGAAATAAATTCACAGTCAAAGAATCAAGCAACTTCAGAAACATTGATGTTGTGTTT GAGCTCGGTGTAAACTTTCCCTACAGTCTAGCAGACGGAACGGAGCTCACTGGGGCCTGGACCATTGAGG GAAATAAACTTATTGGGAAATTCACACGTGTAGACAATGGAAAGGAGCTGATTGCTGTCCGAGAGGTTTC TGGTAATGAACTAATCCAGACCTACACATATGAAGGAGTTGAGGCCAAGCGATTCTTTAAGAAGGAATAA GTCAACTTCTCAGAGCCTGGAGCAACGCTGAAGAGCTAAGCTGATGTCAGATTTCTTTCTCCATCATGCT AATGCCAGGCTCATTCGTCATCCTATCAGCACTGGTCTCCAGCCTTGTCAAAGCTAAAGAAGTAAAAGCT AATTAAAAGAACTTCATTTGTTTTATGATCCTTAAGCTATACATGAACTAGTCTTTTAAAAGAAAATAAA TCCTGTTCTCACACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAA
Restriction Sites EcoRI-NotI     
ACCN BC013457
Insert Size 399 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC013457, AAH13457
RefSeq Size 774 bp
RefSeq ORF 399 bp
Locus ID 14079
Gene Summary The protein encoded by this gene is part of the fatty acid binding protein family (FABP). FABPs are a family of small, highly conserved, cytoplasmic proteins that bind long-chain fatty acids and other hydrophobic ligands and participate in fatty acid uptake, transport, and metabolism. This protein functions within enterocytes, possibly to sense lipids as part of energy homeostasis. In humans polymorphisms are associated with increased fat oxidation and insulin resistance. In mice deficiency of this gene alters body weight in a gender-specific manner and causes hyperinsulinemia. [provided by RefSeq, Jan 2013]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...