Apex1 (BC052401) Mouse Untagged Clone

CAT#: MC206686

Apex1 (untagged) - Mouse apurinic/apyrimidinic endonuclease 1 (cDNA clone MGC:63432 IMAGE:5715485), (10ug)



CN¥ 2,400.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CN¥ 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CN¥ 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CN¥ 480.00


APEX1 Antibody - N-terminal region
    • 50 ug

CN¥ 4,381.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms Apex, APE, HAP1, Ref-1
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC052401
AACAGGCAGACTCCATTCTTTGTGCCGTGAGGGTCTCTGGCTTCGTTGGGAGGCAGCGCAGTAAACACTG CTTCGGTGCTCCAGGAGCCTAAGGGCTTTCGTCACAGCGATGCCAAAGCGGGGAAAGAAAGCGGCGGCCG ACGACGGGGAAGAACCCAAGTCGGAGCCAGAGACCAAGAAGAGTAAGGGGGCAGCAAAGAAAACCGAGAA GGAGGCCGCGGGAGAGGGCCCTGTCCTGTACGAGGACCCTCCAGATCAGAAAACCTCACCCAGTGGCAAA TCTGCCACACTCAAGATATGCTCCTGGAATGTGGATGGGCTTCGAGCCTGGATTAAAAAGAAAGGTTTGG ATTGGGTAAAGGAAGAAGCACCAGATATCTTGTGCCTCCAAGAGACCAAGTGCTCGGAGAACAAACTCCC GGCTGAACTGCAAGAGCTGCCTGGACTCACCCATCAGTACTGGTCAGCTCCGTCAGACAAAGAAGGATAC AGTGGTGTGGGCCTACTTTCCCGCCAGTGCCCGCTAAAAGTCTCTTATGGCATTGGCGAGGAAGAACATG ATCAAGAAGGCCGGGTGATTGTGGCTGAATTTGAGTCCTTTGTCCTGGTAACAGCCTATGTTCCCAATGC AGGCAGGGGTCTGGTAAGACTGGAATACCGACAGCGTTGGGATGAAGCCTTCCGAAAGTTTCTAAAGGAC TTGGCTTCCAGAAAGCCTCTTGTGCTATGTGGGGATCTCAATGTGGCTCATGAAGAAATTGACCTCCGTA ACCCCAAAGGAAACAAAAAGAATGCTGGCTTTACTCCCCAGGAGCGCCAAGGTTTTGGGGAACTGCTACA AGCTGTACCATTGGCTGACAGCTTCCGGCATCTCTACCCCAACACTGCTTACGCTTACACTTTCTGGACT TACATGATGAATGCCCGCTCTAAGAATGTTGGTTGGCGCCTTGATTACTTTTTGCTTTCCCACTCTCTTT TACCTGCATTGTGTGACAGCAAGATCCGGTCCAAGGCTCTTGGCAGTGACCACTGTCCCATCACCCTTTA CCTAGCACTGTGATACCCTCCTGCAGTAGCTTCCTGCCTGGGAGATGGCTCTCTCTGCAGAAGTCTGGTG TTTTAGCCTTCAGGTGTTTGGTTTTGTATGTGCTCCCTCATTTTAAACATTAAACCAAACTTCTGGTTTC CTTTAGACAATCCAAGAGAAATAAAAGGCCCTACTTTCAAAAAAAAAAAAAAAAAAA
Restriction Sites EcoRI-NotI     
ACCN BC052401
Insert Size 954 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC052401, AAH52401
RefSeq Size 1247 bp
RefSeq ORF 954 bp
Locus ID 11792
Gene Summary Multifunctional protein that plays a central role in the cellular response to oxidative stress. The two major activities of APEX1 are DNA repair and redox regulation of transcriptional factors. Functions as a apurinic/apyrimidinic (AP) endodeoxyribonuclease in the DNA base excision repair (BER) pathway of DNA lesions induced by oxidative and alkylating agents. Initiates repair of AP sites in DNA by catalyzing hydrolytic incision of the phosphodiester backbone immediately adjacent to the damage, generating a single-strand break with 5'-deoxyribose phosphate and 3'-hydroxyl ends. Does also incise at AP sites in the DNA strand of DNA/RNA hybrids, single-stranded DNA regions of R-loop structures, and single-stranded RNA molecules. Has a 3'-5' exoribonuclease activity on mismatched deoxyribonucleotides at the 3' termini of nicked or gapped DNA molecules during short-patch BER. Possesses a DNA 3' phosphodiesterase activity capable of removing lesions (such as phosphoglycolate) blocking the 3' side of DNA strand breaks. May also play a role in the epigenetic regulation of gene expression by participating in DNA demethylation. Acts as a loading factor for POLB onto non-incised AP sites in DNA and stimulates the 5'-terminal deoxyribose 5'-phosphate (dRp) excision activity of POLB. Plays a role in the protection from granzymes-mediated cellular repair leading to cell death. Also involved in the DNA cleavage step of class switch recombination (CSR). On the other hand, APEX1 also exerts reversible nuclear redox activity to regulate DNA binding affinity and transcriptional activity of transcriptional factors by controlling the redox status of their DNA-binding domain, such as the FOS/JUN AP-1 complex after exposure to IR. Involved in calcium-dependent down-regulation of parathyroid hormone (PTH) expression by binding to negative calcium response elements (nCaREs). Together with HNRNPL or the dimer XRCC5/XRCC6, associates with nCaRE, acting as an activator of transcriptional repression. Stimulates the YBX1-mediated MDR1 promoter activity, when acetylated at Lys-6 and Lys-7, leading to drug resistance. Acts also as an endoribonuclease involved in the control of single-stranded RNA metabolism. Plays a role in regulating MYC mRNA turnover by preferentially cleaving in between UA and CA dinucleotides of the MYC coding region determinant (CRD). In association with NMD1, plays a role in the rRNA quality control process during cell cycle progression. Associates, together with YBX1, on the MDR1 promoter. Together with NPM1, associates with rRNA. Binds DNA and RNA.[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
Customer Reviews 
Loading...