Rab13 (BC027214) Mouse Untagged Clone

CAT#: MC206577

Rab13 (untagged) - Mouse RAB13, member RAS oncogene family (cDNA clone MGC:25544 IMAGE:3709140), (10ug)



CNY 2,400.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
Rab13 Antibody - middle region
    • 50 ug

CNY 4,628.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 0610007N03Rik; B230212B15Rik
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC027214
GAAAACTTCCTGGCTGGGACTCCGGCGGTTTCTGCCTGCCAACCCTCGGATCCCGCCTACCAGTGTTGGC TCTTCCCGACCCCTCCCCCGGCGCCCCCAGTGTCCGCCATGGCCAAAGCCTACGACCACCTCTTCAAGTT GCTGCTCATCGGGGACTCGGGGGTGGGCAAGACTTGTCTGATCATTCGCTTTGCAGAGGACAACTTCAAC AGCACTTACATCTCTACCATCGGAATTGATTTCAAGATCCGAACCGTGGACATAGAGGGGAAGAGGATCA AACTGCAAGTGTGGGACACGGCTGGCCAAGAACGATTCAAGACAATAACTACCGCCTATTACCGTGGAGC CATGGGCATTATCCTCGTATATGACATCACAGATGAGAAATCCTTCGAGAATATTCAGAACTGGATGAAA AGCATCAAAGAGAATGCCTCTGCGGGAGTGGAGCGCCTCCTGCTGGGAAACAAGTGTGACATGGAGGCCA AGCGGCAGGTGCAGAGAGAGCAGGCGGAGAAGTTGGCTCGAGAGCACAGAATCCGATTTTTTGAGACGAG TGCCAAATCCAGTGTGAATGTGGATGAGGCTTTCAGTTCCCTGGCCCGTGACATCTTGCTCAAGACAGGA GGCCGGAGATCGGGAACCAACAGTAAGCCCTCAAGCACTGGCCTGAAAACATCTGACAAGAAGAAGAACA AGTGCTTGTTAGGCTGAGAGCATTTCTTGCCTCCTATTCACCCTGAACCTGGAGGCTAGACCTGAGGGAG TCGGACTGAGGGATTGCAGATGGGAGAACTGTGGTGGCACCTCAAGGGGAGATGAGGGGAATAAGGAGAC CGGCGAGGACGAGACGGAAGAAAGGGGCAGGGAAAGGAGGGGGAGGAACCAAGGATGTGAAAGGTGAACA GAAGGGATTTGAGAAGAGGAAAGGAAGAAGAAATGAATGGCTCAGGCCTTGGACAGTCCAACATTAAAGT CAACATGCTGATCTCTCCATTCCTGGTTCAGGGTTAGGGTCCTGAGAGGCTGGCTCGGCACTACTCCGAG GGTCCCTCACTCTACAAGGTCTTTGTTAGTATTAAAGGCCACTGTTTTGCATGAAAAAAAAAAAAAAA
Restriction Sites EcoRI-NotI     
ACCN BC027214
Insert Size 609 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC027214, AAH27214
RefSeq Size 1118 bp
RefSeq ORF 609 bp
Locus ID 68328
Gene Summary The small GTPases Rab are key regulators of intracellular membrane trafficking, from the formation of transport vesicles to their fusion with membranes. Rabs cycle between an inactive GDP-bound form and an active GTP-bound form that is able to recruit to membranes different sets of downstream effectors directly responsible for vesicle formation, movement, tethering and fusion. That Rab is involved in endocytic recycling and regulates the transport to the plasma membrane of transmembrane proteins like the tight junction protein OCLN/occludin. Thereby, it regulates the assembly and the activity of tight junctions. Moreover, it may also regulate tight junction assembly by activating the PKA signaling pathway and by reorganizing the actin cytoskeleton through the activation of the downstream effectors PRKACA and MICALL2 respectively. Through its role in tight junction assembly, may play a role in the establishment of Sertoli cell barrier. Plays also a role in angiogenesis through regulation of endothelial cells chemotaxis. Also involved in neurite outgrowth. Has also been proposed to play a role in post-Golgi membrane trafficking from the TGN to the recycling endosome. Finally, it has been involved in insulin-induced transport to the plasma membrane of the glucose transporter GLUT4 and therefore may play a role in glucose homeostasis.[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
Customer Reviews 
Loading...