Polr2k (BC028543) Mouse Untagged Clone

Specifications

Product Data
Type	Mouse Untagged Clone
Tag	Tag Free
Synonyms	MafY, RPB12, RPABC4, RPB7.0, RPB10alpha
Vector	PCMV6-Kan/Neo
E. coli Selection	Kanamycin (25 ug/mL)
Mammalian Cell Selection	Neomycin
Sequence Data	Fully Sequenced ORF (showhide) >BC028543 CGCTTCTTCCAGCTGTGGAGGCACTAACAATGGACGCTCAGAAAGATGTTCAACCACCAAAGCAGCAGCC AATGATATATATTTGTGGAGAGTGTCACACCGAAAATGAGATAAAGTCCAGGGATCCCATCAGATGCAGA GAATGTGGATACAGAATAATGTACAAGAAAAGGACTAAAAGATTGGTGGTTTTTGATGCTCGATGAAATG TGGGAGTTCAGAAGTATCTTCATTCATACATTTGCCTCATTGATGTTTCTCTTTAATGTATAGCATTTGG CTTAGTTTACTTAATGAAAACAACTGTATGCCTATGATTTCATTTAGAAATACAATTGTATTTTAATACT TTGTATAAAGGAAATTTTGGTTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites	EcoRI-NotI
ACCN	BC028543
Insert Size	177 bp
OTI Disclaimer	Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components	The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution	1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note	Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq	BC028543, AAH28543
RefSeq Size	480 bp
RefSeq ORF	177 bp
Locus ID	17749
Gene Summary	DNA-dependent RNA polymerase catalyzes the transcription of DNA into RNA using the four ribonucleoside triphosphates as substrates. Common component of RNA polymerases I, II and III which synthesize ribosomal RNA precursors, mRNA precursors and many functional non-coding RNAs, and a small RNAs, such as 5S rRNA and tRNAs, respectively (By similarity).[UniProtKB/Swiss-Prot Function]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.