United States
Germany
Japan
United Kingdom
China
Asgr2 (NM_007493) Mouse Untagged Clone
CAT＃: MC205737
Asgr2 (untagged) - Mouse asialoglycoprotein receptor 2 (Asgr2), (10ug)
CNY 3,600.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | A; AS; Asg; ASGPR2; Asgr; Asgr-2; HL-2 |
| Vector | PCMV6-Kan/Neo |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>BC011197
GACCCAGCTCTTGCCTAGATTGGCCCCTCCTCCCTCTCACCTAGCTCCACTAGCACCACCTGTCCCGTCT CCCAGGTTTAGCCCCTCTTTCTCCTTGGGCTCAGGCTGTCTCCGAAAGCCAGAGTCAGCTCTCTATACCT TTAACAGCCCTTAGGGCCATCATGGAGAAGGACTGTCAAGACATCCAGCAGCTGGACTCTGAGGAGAATG ACCATCAGCTCAGTGGCGATGACGAACACGGCTCTCATGTGCAGGATCCTAGGATAGAAAATCCACACTG GAAAGGGCAGCCTCTTTCCAGGCCCTTTCCTCAGCGCCTCTGCTCCACGTTCCGCCTCAGTCTGCTCGCC CTGGCCTTCAACATCCTCCTGTTGGTGGTCATCTGTGTGGTTTCATCTCAAAGCATACAGCTGCAAGAAG AGTTTCGGACCCTGAAAGAAACCTTCAGCAACTTTTCCTCCAGCACCCTGATGGAGTTCGGGGCTCTGGA CACCCTCGGAGGTAGCACAAACGCCATACTGACTTCCTGGTTAGCCCAACTGGAGGAGAAGCAGCAACAG CTAAAGGCAGACCATTCCACATTGCTCTTTCACCTGAAGCACTTCCCAATGGATCTGCGAACCCTGACCT GTCAGCTGGCGTACTTCCAGAGCAATGGCACGGAATGCTGCCCTGTTAACTGGGTGGAGTTCGGGGGAAG CTGCTACTGGTTTTCTCGGGATGGGCTCACCTGGGCTGAGGCTGACCAGTACTGCCAGCTGGAGAACGCC CACCTGCTGGTCATCAACTCCAGGGAGGAGCAGGACTTTGTTGTAAAGCACAGGAGCCAGTTTCATATTT GGATAGGTCTTACCGACAGGGATGGCTCCTGGAAATGGGTGGATGGAACTGATTATAGAAGCAACTACAG GAATTGGGCCTTCACTCAGCCAGATAACTGGCAGGGCCATGAACAGGGTGGAGGTGAAGACTGTGCTGAA ATCCTGTCAGATGGCCATTGGAATGACAACTTCTGCCAGCAGGTGAACCGCTGGGTATGCGAAAAGAGAC GGAACATCACCCACTAGGAGTCGGCTCGACCAATCCCCCACCCCGCCCCCACCCCCACATCCCCCACTAG GAGTCTGCTCAATCATGCCTCTGCCCTACCTCCAGCCCCACACCACCCCAACATCCTCACTGGGGATACT GGAGCAAGGAAGAGAAACAGGGTCCCAAGCATGAGGAGGGGTTATGGAAAACTGGAAAGGGCATGGCTCT ATGGTCTCATACCTTAGGAAGACTGAGAATCCCCCCTTCTGCACAATTTATTGCAATTGTTATAAATTTC AGCCTTCTGAATGGAGTAGGAAAAAAAAGAGAAAGACTTGAAAAAAAAAAAAAAA |
| Restriction Sites | RsrII-NotI |
| ACCN | NM_007493 |
| Insert Size | 906 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC011197, AAH11197 |
| RefSeq Size | 1385 bp |
| RefSeq ORF | 906 bp |
| Locus ID | 11890 |
| UniProt ID | P24721 |
| Gene Summary | This gene encodes a subunit of the asialoglycoprotein receptor. This receptor is a transmembrane protein that plays a critical role in serum glycoprotein homeostasis by mediating the endocytosis and lysosomal degradation of glycoproteins with exposed terminal galactose or N-acetylgalactosamine residues. The asialoglycoprotein receptor is a hetero-oligomeric protein composed of major and minor subunits, which are encoded by different genes. The protein encoded by this gene is the less abundant minor subunit. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene [provided by RefSeq, Sep 2015] Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1, 2, and 3 all encode the same isoform (a). Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG204202 | Asgr2 (tGFP-tagged) - Mouse asialoglycoprotein receptor 2 (Asgr2) |
CNY 4,370.00 |
|
| MR204202 | Asgr2 (Myc-DDK-tagged) - Mouse asialoglycoprotein receptor 2 (Asgr2) |
CNY 3,600.00 |
|
| MR204202L3 | Lenti ORF clone of Asgr2 (Myc-DDK-tagged) - Mouse asialoglycoprotein receptor 2 (Asgr2) |
CNY 6,000.00 |
|
| MR204202L4 | Lenti ORF clone of Asgr2 (mGFP-tagged) - Mouse asialoglycoprotein receptor 2 (Asgr2) |
CNY 5,890.00 |
