United States
Germany
Japan
United Kingdom
China
Uqcrh (NM_025641) Mouse Untagged Clone
CAT＃: MC205687
Uqcrh (untagged) - Mouse ubiquinol-cytochrome c reductase hinge protein (Uqcrh), nuclear gene encoding mitochondrial protein, (10ug)
CNY 1,200.00
CNY 2,000.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | 2210416J04Rik; 2310021J10Rik; 2610041P16Rik |
| Vector | PCMV6-Kan/Neo |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>BC011388
GTACTACTCTGGTTGCGCTTGTTGGATCCCAAACCGGCTCCCGACATGGGACTAGAGGACGAACGAAAGA TGCTCACTGGATCTGGAGACCCCAAAGAGGAAGAAGAGGAAGAACTAGTGGACCCCCTAACAACAGTGAG AGAGCACTGTGAACAGCTGGAGAAGTGTGTAAAGGCCCGGGAACGACTAGAGTTGTGTGATAATCGCGTG TCTTCTCGGTCACAGACAGAAGAGGATTGTACAGAGGAGCTCTTTGACTTCTTGCATGCACGGGACCACT GTGTGGCCCACAAGCTCTTTAAAAACTTGAAGTAAATGTGCAGATTCGTCCTCCTCAGCCTTGTCACTGG GAATCAGGAACAGTTCCTTGTGGTTCTGGACGTCGGTGTCTGATGGAGTGAGTTCTCGAGAACCTCACTG ACTTTGGCGGTAGCTTCTCTTCTGTGTGACTAGCAGTGACTTCATCTTAATAAACTGATCTGCAAACTTA AAAAAAAAAAAAAAAA |
| Restriction Sites | RsrII-NotI |
| ACCN | NM_025641 |
| Insert Size | 270 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC011388, AAH11388 |
| RefSeq Size | 506 bp |
| RefSeq ORF | 270 bp |
| Locus ID | 66576 |
| UniProt ID | P99028 |
| Gene Summary | This is a component of the ubiquinol-cytochrome c reductase complex (complex III or cytochrome b-c1 complex), which is part of the mitochondrial respiratory chain. This protein may mediate formation of the complex between cytochromes c and c1 (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG200223 | Uqcrh (tGFP-tagged) - Mouse ubiquinol-cytochrome c reductase hinge protein (Uqcrh) |
CNY 2,850.00 |
|
| MR200223 | Uqcrh (Myc-DDK-tagged) - Mouse ubiquinol-cytochrome c reductase hinge protein (Uqcrh), nuclear gene encoding mitochondrial protein |
CNY 1,200.00 |
|
| MR200223L3 | Lenti ORF clone of Uqcrh (Myc-DDK-tagged) - Mouse ubiquinol-cytochrome c reductase hinge protein (Uqcrh), nuclear gene encoding mitochondrial protein |
CNY 4,750.00 |
|
| MR200223L4 | Lenti ORF clone of Uqcrh (mGFP-tagged) - Mouse ubiquinol-cytochrome c reductase hinge protein (Uqcrh), nuclear gene encoding mitochondrial protein |
CNY 4,750.00 |
