Ndufa7 (NM_023202) Mouse Untagged Clone

CAT#: MC205082

Ndufa7 (untagged) - Mouse NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 7 (B14.5a) (Ndufa7), nuclear gene encoding mitochondrial protein, (10ug)



  "NM_023202" in other vectors (4)

CNY 1,200.00

CNY 2,000.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 14.5kD; 14.5kDa; 2400007M02Rik; CI-B14.5a
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC055698
GCGTCCTTCGGAGCGGAAGGAATATGGCGTCCGCTACTCGCGTTATCCAAAAGCTGCGGAACTGGGCGTC TGGGCAAGACCTGCAGGCGAAGCTACAGCTGCGCTACCAGGAGATCGCCAAGCGGACCCAGCCACCTCCG AAACTCCCCGTGGGCCCCAGTCACAAGCTGTCCAACAATTACTACTGTACTCGTGATGGCCGCCGGGAAG TTGTGCCTCCCTCAATCATCATGTCCTCACAAAAGGCCCTGGTGTCAGGCAAGGCCGCCGAGAGTTCTGC AATGGCAGCCACTGAGAAGAAGGCAGTGACACCTGCTCCTCCCATGAAGAGGTGGGAGCTGTCCAAGGAC CAGCCATACCTGTGACCCTGCCCTAGGTTACCTTGCTATATATGTCTCTAGGGCCACATGACTGCTTTTC CTCCTTGGACTCCCTCTGGGGAGAGTGTGACCTAATTTGTAACAAATATATAGAATTCCACATTAAAAAA AAAAAAAAAAAAAA
Restriction Sites AscI-NotI     
ACCN NM_023202
Insert Size 342 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC055698, AAH55698
RefSeq Size 504 bp
RefSeq ORF 342 bp
Locus ID 66416
UniProt ID Q9Z1P6
Gene Summary This gene encodes a subunit of the NADH-ubiquinone oxidoreductase (complex I) enzyme, which is a large, multimeric protein. It is the first enzyme complex in the mitochondrial electron transport chain and catalyzes the transfer of electrons from NADH to the electron acceptor ubiquinone. The proton gradient created by electron transfer drives the conversion of ADP to ATP. Complex I has been biochemically separated into four fractions. The bovine ortholog of this protein has been reported to be part of the I-lambda fraction, which forms the extrinsic globular domain. In humans, deficiencies in complex I are associated with myopathies, encephalomyopathies, and neurodegenerative disorders. Pseudogenes of this gene are located on chromosomes 7 and 16. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2013]
Transcript Variant: This variant (1) encodes the functional protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...