United States
Germany
Japan
United Kingdom
China
Immp2l (NM_053122) Mouse Untagged Clone
CAT＃: MC205005
Immp2l (untagged) - Mouse IMP2 inner mitochondrial membrane peptidase-like (S. cerevisiae) (Immp2l), nuclear gene encoding mitochondrial protein, (10ug)
CNY 2,400.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | AI853880; IMP2; Tg(HLA-A/H2-D)2Enge |
| Vector | PCMV6-Kan/Neo |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>BC100557
CGCAGCGGGATTTTGGCCAAATTGGGCGAGGGTACAATATTACCACTTACCCCTTCTCACCGAGGAAGAG CGGGAGAAAGGGTATGGCACAGTCACAAAGCTGGGCGAGAAGATGCTTCAAGGCCTTTTGCAAAGGCTTC TTCGTGGCGGTGCCCGTGGCAGTCACTTTCTTGGATCGCGTGGCCTGCGTGGCTCGGGTGGAAGGCTCGT CAATGCAGCCTTCTTTGAATCCTGGAGGAAGCCAGTCCTCAGATGTGGTACTTTTGAACCACTGGAAAGT GAGAAATTTTGAAGTACAGCGTGGTGACATTGTGTCATTGGTCTCTCCTAAAAACCCAGAACAGAAAATC ATTAAGAGAGTGATCGCTCTTGAAGGAGATATTGTAAGAACAATTGGACACAAAAACCGGTTGGTCAAAG TCCCCCGCGGTCACATGTGGGTTGAAGGCGATCATCATGGACACAGTTTTGATAGTAATTCTTTTGGACC GGTTTCTCTGGGACTCCTGCATGCCCATGCCACACATATTTTGTGGCCTCCAGAGCGCTGGCAGAGACTG GAATCTGTTCTTCCTCCAGAGCGCTGTCCACTCCAGACTGGTGAGAAATAACTGCACAAGAGCCCACCAT AGGAGGAGCTGAACACACCAGATGCCTCCTTCTGGAGGGAGATGTTCCAGTGATGCTGAACACAAGACCT CTGTATATCTTTAAGGTTGTCTGGAATTTCCATATTAAACAGTATTAAATGGCAAAAAAAAAAAAAAAAA AAAAAA |
| Restriction Sites | SfiI-SfiI |
| ACCN | NM_053122 |
| Insert Size | 528 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | BC100557, AAI00558 |
| RefSeq Size | 776 bp |
| RefSeq ORF | 528 bp |
| Locus ID | 93757 |
| UniProt ID | Q8BPT6 |
| Gene Summary | Catalyzes the removal of transit peptides required for the targeting of proteins from the mitochondrial matrix, across the inner membrane, into the inter-membrane space. Known to process the nuclear encoded protein DIABLO (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG201526 | Immp2l (tGFP-tagged) - Mouse IMP2 inner mitochondrial membrane peptidase-like (S |
CNY 2,850.00 |
|
| MR201526 | Immp2l (Myc-DDK-tagged) - Mouse IMP2 inner mitochondrial membrane peptidase-like (S. cerevisiae) (Immp2l), nuclear gene encoding mitochondrial protein |
CNY 2,400.00 |
|
| MR201526L3 | Lenti ORF clone of Immp2l (Myc-DDK-tagged) - Mouse IMP2 inner mitochondrial membrane peptidase-like (S. cerevisiae) (Immp2l), nuclear gene encoding mitochondrial protein |
CNY 4,750.00 |
|
| MR201526L4 | Lenti ORF clone of Immp2l (mGFP-tagged) - Mouse IMP2 inner mitochondrial membrane peptidase-like (S. cerevisiae) (Immp2l), nuclear gene encoding mitochondrial protein |
CNY 4,750.00 |
