Eif4ebp3 (NM_201256) Mouse Untagged Clone
CAT#: MC204980
Eif4ebp3 (untagged) - Mouse eukaryotic translation initiation factor 4E binding protein 3 (Eif4ebp3), (10ug)
CNY 1,200.00
CNY 2,000.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 4e-bp3 |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC061242
AGGTGGGTGGAGCCCTCAAGTTGACTGGCCAGTGGCCTGCCCCGGGTGTAACATATTCTAGTTGTTGCCT GCTGCGACTGCCTACACCTCAGAGCTGTTTTCCACGCTTTCAAGGCACCAGCTCTTGCCTTCCTGCTGCT ATGTCCTCGTCCACGAGTTGCCCAATTCCAGGGTGCCGGGACCAGCTGCCAGACGGCTACAGCACCACGC CTGGCGGCACACTATACGCCACTACCCCGGGAGGCACCAGGATCATCTACGACAGAAAGTTCCTGCTGGA GTGCAAGAACTCACCCATTGCCCGGACACCTCCCTGCTGCCTCCCTCAGATTCCCGGGGTCACAACTCTC CCAGCAGTACCACCCTCCAAGTTGGAGTTGCTGAAGGAACAGAAGCAGACAGAGGTAGAAATAACCGATG ACGAACAGTTTGAAATGGACATGTAATCTAGTGCAAAATGACCTGTATGGAGTAATGGAAGGAGCTCTCA TCCTACTATTGCCATCACCTCTTCCTGGGTATCCAAGGGCCAGCTGGCCTCATCTAATCCAGAAAAGAAT GACTTGTTGGTTCTGGGCTTCCTTTAGTTGAGGCAGCTAGACCAGGGATAGCAGCGGGCAACCTGCCAAG CCTTTAGCTTTCTCTGGTCTATACATATTCCTCCCAAACCTCTTCCCCTCAGGGCTGGCACTGGGGAACA GAGTATGTCACCTTCTGGCTGCTTAGTAAACTTCCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | SfiI-SfiI |
ACCN | NM_201256 |
Insert Size | 306 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC061242, AAH61242 |
RefSeq Size | 766 bp |
RefSeq ORF | 306 bp |
Locus ID | 108112 |
UniProt ID | Q80VV3 |
Gene Summary | Repressor of translation initiation that regulates EIF4E activity by preventing its assembly into the eIF4F complex: hypophosphorylated form competes with EIF4G1/EIF4G3 and strongly binds to EIF4E, leading to repress translation. In contrast, hyperphosphorylated form dissociates from EIF4E, allowing interaction between EIF4G1/EIF4G3 and EIF4E, leading to initiation of translation.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG200316 | Eif4ebp3 (tGFP-tagged) - Mouse eukaryotic translation initiation factor 4E binding protein 3 (Eif4ebp3) |
CNY 2,800.00 |
|
MR200316 | Eif4ebp3 (Myc-DDK-tagged) - Mouse eukaryotic translation initiation factor 4E binding protein 3 (Eif4ebp3) |
CNY 1,200.00 |
|
MR200316L3 | Lenti ORF clone of Eif4ebp3 (Myc-DDK-tagged) - Mouse eukaryotic translation initiation factor 4E binding protein 3 (Eif4ebp3) |
CNY 4,750.00 |
|
MR200316L4 | Lenti ORF clone of Eif4ebp3 (mGFP-tagged) - Mouse eukaryotic translation initiation factor 4E binding protein 3 (Eif4ebp3) |
CNY 4,750.00 |
其它Eif4ebp3产品