Gng13 (NM_022422) Mouse Untagged Clone

CAT#: MC204951

Gng13 (untagged) - Mouse guanine nucleotide binding protein (G protein), gamma 13 (Gng13), (10ug)



  "NM_022422" in other vectors (4)

CN¥ 1,200.00

CN¥ 2,000.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CN¥ 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CN¥ 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CN¥ 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 1500031D04Rik; AB030194; Ggamma13
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC059712
GGGGCGTCTCGGGGTGCACCGGCGGCCGGGCTCCGGCGGCGGCAGCAGCGCAGCCTCAGGCTGGCTACCA CCGACGCCCCCGACGCCATGGAGGAGTGGGATGTGCCCCAGATGAAGAAGGAGGTAGAGAGCCTCAAGTA CCAACTGGCCTTCAAGAGGGAGATGTCGTCCAAGACCATCCCCGAGCTTCTCAAGTGGATTGAGGATGGA ATCCCCAAGGACCCCTTCCTGAACCCAGACCTGATGAAGAACAACCCTTGGGTAGAGAAGGCCAAGTGCA CCATCCTATGAGCCTGACCCACACTCTCTGTAAGGTGTGACTTTATAAATAGACTTCTCCGGGTGCCAAA AAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites SfiI-SfiI     
ACCN NM_022422
Insert Size 204 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC059712, AAH59712
RefSeq Size 377 bp
RefSeq ORF 204 bp
Locus ID 64337
UniProt ID Q9JMF3
Gene Summary Guanine nucleotide-binding proteins (G proteins) are involved as a modulator or transducer in various transmembrane signaling systems. The beta and gamma chains are required for the GTPase activity, for replacement of GDP by GTP, and for G protein-effector interaction.[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...