United States
Germany
Japan
United Kingdom
China
Otub2 (NM_026580) Mouse Untagged Clone
CAT＃: MC204918
Otub2 (untagged) - Mouse OTU domain, ubiquitin aldehyde binding 2 (Otub2), transcript variant 2, (10ug)
CNY 3,600.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | 2010015L18Rik; 4930586I02Rik; AI413508; AW557219; OTB2; OTU2 |
| Vector | PCMV6-Kan/Neo |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>BC049551
GGGACACAGTGGAGGTCTGCGCTCCGGTCTGAGGGGCGGTCGGGTGTATTCTGCGCTCACCCACACCCGC GAGGCCCGCGCCGCCCGACCCAACGGCGGAGCCGCCCAGCGCCTCCCCTGGCACCCGCTCGCTCCTCGCT GGGGCGGGACGAGGCCCGACGGCTCCGGTCACTATGAGTGAAACATCTTTCAACCTAATATCAGAAAAAT GTGACATTCTATCCATTCTTCGGGATCATCCTGAAAACAGGATTTACCAGAGGAAAATCCAGGAACTCAG CAAAAGATTCACCTCGATCCGGAAGACCAAAGGAGACGGAAACTGCTTCTACAGGGCCTTAGGCTATTCC TACCTGGAGTCCTTGCTGGGCAAGAGCAGAGAGATCCTCAAGTTCAAAGAGCGTGTGCTACAGACCCCAA ATGACCTTCTGGCTGCCGGCTTTGAGGAACACAAGTTCAGAAACTTCTTTAATGCTTTTTACAGTGTGGT TGAGCTGGTAGAGAAGGATAGCTCAGTGTCCAGCCTGCTGAAGGTGTTCAATGACCAGAGTTCCTCGGAC CGAATCGTGCAGTTCTTACGCCTCCTCACGTCGGCCTTCATCAGGAACCGAGCTGACTTCTTCCGACATT TCATTGATGAGGAGATGGACATCAAAGACTTCTGCACTCACGAAGTAGAGCCCATGGCCATGGAGTGTGA CCACGTGCAGATCACAGCCCTGTCGCAGGCACTCAACATTGCTCTGCAGGTAGAGTACGTCGACGAGATG GACACCGCTCTGAACCACCACGTGTTCCCCGAGGCTGCCATCCCTTCGGTTTATCTGCTCTATAAAACAT CCCACTACAACATCCTTTACGCAGCCGAGAAACACTGACTACTTTTGGGCCATGCCGGAGCCCGTCATCG AATGGACTGCATTCTGAATGGAACATCCTGCCTTGGCAATTTTTTTGAGTGACTTAGACAACTAGGAAAC ATATAGCCTCTTGGGTAAAGCCACACTGAACTGAGACCTGTGCCCACTATGGACTGTGAATGACTTAATA GGAATTTTAGTATTTATTTTGATAGATGATATAATGCCTGCTAACTCTGGACCACAAGGCCAGAAACTCT TCTCTCTGTACCCATTTACTTCAAGAACCCCATTGGACCGTAAAAAAAAAAAAAAAAAAAAAAAAAAAAA A |
| Restriction Sites | SfiI-SfiI |
| ACCN | NM_026580 |
| Insert Size | 705 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | BC049551, AAH49551 |
| RefSeq Size | 1191 bp |
| RefSeq ORF | 705 bp |
| Locus ID | 68149 |
| UniProt ID | Q9CQX0 |
| Gene Summary | Hydrolase that can remove conjugated ubiquitin from proteins in vitro and may therefore play an important regulatory role at the level of protein turnover by preventing degradation. Mediates deubiquitination of 'Lys-11'-,'Lys-48'- and 'Lys-63'-linked polyubiquitin chains, with a preference for 'Lys-63'-linked polyubiquitin chains (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) lacks an internal exon in the 5' region, as compared to variant 1. The resulting isoform (2) is shorter and has a different N-terminus, as compared to isoform 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG202832 | Otub2 (tGFP-tagged) - Mouse OTU domain, ubiquitin aldehyde binding 2 (Otub2) |
CNY 5,200.00 |
|
| MR202832 | Otub2 (Myc-DDK-tagged) - Mouse OTU domain, ubiquitin aldehyde binding 2 (Otub2), transcript variant 2 |
CNY 3,600.00 |
|
| MR202832L3 | Lenti ORF clone of Otub2 (Myc-DDK-tagged) - Mouse OTU domain, ubiquitin aldehyde binding 2 (Otub2), transcript variant 2 |
CNY 5,890.00 |
|
| MR202832L4 | Lenti ORF clone of Otub2 (mGFP-tagged) - Mouse OTU domain, ubiquitin aldehyde binding 2 (Otub2), transcript variant 2 |
CNY 5,890.00 |
