Nhp2 (NM_026631) Mouse Untagged Clone
CAT#: MC204573
Nhp2 (untagged) - Mouse NHP2 ribonucleoprotein homolog (yeast) (Nhp2), (10ug)
CNY 1,200.00
CNY 2,000.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 2410130M07Rik; D11Ertd175e; Nola2 |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC024944
GTTCCTCTATGCCGGGACGGAGTTGTAGTTGCTAAGATGACCAAAGTAAAGGCCGCTCCCGAAGAGTCCG AGGCGCAGGCGGAGGGCTGCAGCGAGGAGCGCACGTACAAAGAGCTGCTGGTCAATCTGAACCCCATCGC GCAGCCCCTGGCTTCCCGCCGCCTGACGCGCAAGCTCTACAAGTGCATCAAGAAGGCTGTGAAGCAGAAG CAGATTCGTCGCGGGGTGAAGGAGGTTCAGAAATTTGTCAACAAGGGCGAGAAAGGGATCATGGTTTTGG CAGGAGATACATTGCCGATTGAGGTGTACTGCCATCTTCCAGTTCTGTGCGAGGACCAGAACTTGCCCTA CGTCTACATCCCCTCTAAGACGGACTTGGGTGCAGCCACAGGCTCCAAGCGTCCCACTTGTGTGATCATG GTGAAGCCCCATGAAGAATATCAGGAGACCTACGACAAGTGCCTGGAGGAGGTGCAGGCACTGCCTACAC CTCTGTGAGAGACTTGGGCTGCAACCCAGCCCCTTTCCAAGAGATCTGGCTGGCTGCAGGCAGCTGCCCA CCCTAACAGCATCTCCCCGATTTCTTGCTGTGTGAGTCTTCCCAGGCAGCTCCAGCAGTGTTGGAGGTGG AGCCTGCATCTCTGCCATCTCCTCCTGAGCTTTGATGAAGACAGTTCCAAGAATGTGGGATAGAAGTAAA TGCTAAGGCGAAAACGTGAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_026631 |
Insert Size | 462 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC024944, AAH24944 |
RefSeq Size | 728 bp |
RefSeq ORF | 462 bp |
Locus ID | 52530 |
UniProt ID | Q9CRB2 |
Gene Summary | Required for ribosome biogenesis and telomere maintenance. Part of the H/ACA small nucleolar ribonucleoprotein (H/ACA snoRNP) complex, which catalyzes pseudouridylation of rRNA. This involves the isomerization of uridine such that the ribose is subsequently attached to C5, instead of the normal N1. Each rRNA can contain up to 100 pseudouridine ("psi") residues, which may serve to stabilize the conformation of rRNAs. May also be required for correct processing or intranuclear trafficking of TERC, the RNA component of the telomerase reverse transcriptase (TERT) holoenzyme (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG201118 | Nhp2 (tGFP-tagged) - Mouse nucleolar protein family A, member 2 (Nola2) |
CNY 2,850.00 |
|
MR201118 | Nhp2 (Myc-DDK-tagged) - Mouse NHP2 ribonucleoprotein homolog (yeast) (Nhp2) |
CNY 1,200.00 |
|
MR201118L3 | Lenti ORF clone of Nhp2 (Myc-DDK-tagged) - Mouse NHP2 ribonucleoprotein homolog (yeast) (Nhp2) |
CNY 4,750.00 |
|
MR201118L4 | Lenti ORF clone of Nhp2 (mGFP-tagged) - Mouse NHP2 ribonucleoprotein homolog (yeast) (Nhp2) |
CNY 4,750.00 |